Mutagenetix > Incidental Mutation

Incidental Mutation 'R2343:Col20a1'

245893

Institutional Source

Beutler Lab

Gene Symbol

Col20a1

Ensembl Gene

ENSMUSG00000016356

Gene Name

collagen, type XX, alpha 1

Synonyms

1700051I12Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2343 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

180986535-181018363 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 181001331 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 865 (T865A)

Ref Sequence

ENSEMBL: ENSMUSP00000104484 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108856] [ENSMUST00000149179] [ENSMUST00000228434]

AlphaFold

Q923P0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108856
AA Change: T865A

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356
AA Change: T865A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	24	103	2.18e1	SMART
VWA	175	354	4.68e-55	SMART
FN3	375	453	6.2e-7	SMART
FN3	464	543	7.34e-9	SMART
FN3	555	633	8.18e-7	SMART
FN3	644	723	8.98e-4	SMART
FN3	738	817	1.43e-11	SMART
TSPN	840	1035	6.45e-31	SMART
Pfam:Collagen	1067	1125	3.8e-9	PFAM
Pfam:Collagen	1122	1174	7.4e-9	PFAM
Pfam:Collagen	1165	1223	3e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149179
AA Change: T823A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356
AA Change: T823A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	24	103	2.18e1	SMART
VWA	175	354	4.68e-55	SMART
FN3	375	453	6.2e-7	SMART
FN3	464	543	7.34e-9	SMART
FN3	555	633	8.18e-7	SMART
FN3	644	723	8.98e-4	SMART
FN3	738	817	1.43e-11	SMART
TSPN	840	1035	6.45e-31	SMART
low complexity region	1069	1106	N/A	INTRINSIC
low complexity region	1108	1121	N/A	INTRINSIC
low complexity region	1136	1155	N/A	INTRINSIC
Blast:TSPN	1156	1202	2e-19	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152473

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228434
AA Change: T823A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcr	T	C	10: 75,145,422	I691T	probably benign	Het
Dmxl1	G	A	18: 49,890,678	R1676H	probably damaging	Het
Dsg2	T	C	18: 20,602,298	V1111A	probably damaging	Het
Eif3g	T	C	9: 20,895,154	Y213C	probably damaging	Het
Fat4	C	T	3: 38,957,105	S2118F	probably damaging	Het
Gpr85	A	G	6: 13,836,696	S70P	probably damaging	Het
Krtap31-1	A	C	11: 99,908,021	T17P	possibly damaging	Het
Lig1	A	G	7: 13,292,195		probably null	Het
Lman2l	A	T	1: 36,428,109	D269E	possibly damaging	Het
Mcc	A	G	18: 44,459,797		probably null	Het
Nav2	T	C	7: 49,598,817	F2302L	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1282	A	G	2: 111,335,700	I126T	probably damaging	Het
Olfr1342	C	A	4: 118,690,187	M88I	probably benign	Het
Sema6c	T	C	3: 95,167,083	F67L	probably damaging	Het
Sez6l	A	T	5: 112,464,731	V448D	probably damaging	Het
Smoc2	A	G	17: 14,344,342	K160R	probably benign	Het
Spata2	A	T	2: 167,483,360	V513E	probably damaging	Het
Susd3	T	A	13: 49,238,859	M107L	probably damaging	Het
Tnni3k	A	G	3: 154,938,829	I564T	probably benign	Het
Zfp971	A	G	2: 178,032,994	K129E	possibly damaging	Het

Other mutations in Col20a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Col20a1	APN	2	181003479	missense	possibly damaging	0.93
IGL00975:Col20a1	APN	2	180992478	missense	probably damaging	1.00
IGL01094:Col20a1	APN	2	180999766	missense	probably damaging	0.99
IGL01388:Col20a1	APN	2	181003471	missense	probably benign	0.24
IGL01472:Col20a1	APN	2	181007832	missense	probably benign	0.44
IGL01936:Col20a1	APN	2	181009368	splice site	probably benign
IGL02133:Col20a1	APN	2	181007144	missense	probably damaging	1.00
IGL02318:Col20a1	APN	2	181007159	missense	probably damaging	0.99
IGL02576:Col20a1	APN	2	181013405	nonsense	probably null
IGL02822:Col20a1	APN	2	180996807	missense	probably damaging	1.00
IGL02898:Col20a1	APN	2	180989112	nonsense	probably null
IGL03056:Col20a1	APN	2	180994889	missense	probably damaging	1.00
IGL03189:Col20a1	APN	2	181009407	nonsense	probably null
IGL03196:Col20a1	APN	2	181007878	splice site	probably null
R0001:Col20a1	UTSW	2	180984412	unclassified	probably benign
R0200:Col20a1	UTSW	2	181000438	missense	probably damaging	1.00
R0384:Col20a1	UTSW	2	180999162	missense	probably benign	0.00
R0964:Col20a1	UTSW	2	180984485	unclassified	probably benign
R0975:Col20a1	UTSW	2	181006826	missense	possibly damaging	0.75
R1359:Col20a1	UTSW	2	180999792	missense	probably benign	0.02
R1395:Col20a1	UTSW	2	180998607	missense	probably damaging	0.99
R1470:Col20a1	UTSW	2	180994960	missense	probably benign	0.01
R1470:Col20a1	UTSW	2	180994960	missense	probably benign	0.01
R1508:Col20a1	UTSW	2	180992577	missense	probably damaging	0.98
R1865:Col20a1	UTSW	2	181015813	missense	possibly damaging	0.87
R1883:Col20a1	UTSW	2	180992910	missense	possibly damaging	0.52
R1884:Col20a1	UTSW	2	180992910	missense	possibly damaging	0.52
R1906:Col20a1	UTSW	2	180998697	missense	probably benign	0.00
R2020:Col20a1	UTSW	2	181013163	critical splice donor site	probably null
R2121:Col20a1	UTSW	2	180996456	missense	probably damaging	0.99
R2131:Col20a1	UTSW	2	180992573	missense	probably damaging	1.00
R3153:Col20a1	UTSW	2	181008593	missense	probably damaging	1.00
R3430:Col20a1	UTSW	2	181013285	nonsense	probably null
R3547:Col20a1	UTSW	2	180994911	missense	probably damaging	1.00
R3844:Col20a1	UTSW	2	180992449	missense	probably damaging	1.00
R3914:Col20a1	UTSW	2	180998492	missense	probably benign	0.00
R4414:Col20a1	UTSW	2	181001250	missense	possibly damaging	0.92
R4711:Col20a1	UTSW	2	180992491	missense	probably damaging	1.00
R4760:Col20a1	UTSW	2	180984403	unclassified	probably benign
R4771:Col20a1	UTSW	2	180989124	missense	probably benign	0.17
R4809:Col20a1	UTSW	2	180998661	missense	probably damaging	1.00
R4872:Col20a1	UTSW	2	180997363	missense	possibly damaging	0.74
R5045:Col20a1	UTSW	2	181006845	missense	probably damaging	1.00
R5238:Col20a1	UTSW	2	180998586	missense	probably damaging	1.00
R5566:Col20a1	UTSW	2	180986523	splice site	probably null
R6389:Col20a1	UTSW	2	180992583	splice site	probably null
R6422:Col20a1	UTSW	2	181014819	missense	possibly damaging	0.75
R6924:Col20a1	UTSW	2	180996850	missense	probably damaging	1.00
R6982:Col20a1	UTSW	2	180996706	missense	probably benign	0.00
R7177:Col20a1	UTSW	2	180994214	nonsense	probably null
R7195:Col20a1	UTSW	2	181007231	missense	probably damaging	1.00
R7717:Col20a1	UTSW	2	181007615	missense	probably damaging	1.00
R7872:Col20a1	UTSW	2	180986578	missense	probably benign	0.14
R8183:Col20a1	UTSW	2	180998414	missense
R8188:Col20a1	UTSW	2	181016333	critical splice donor site	probably null
R8331:Col20a1	UTSW	2	180996766	missense	possibly damaging	0.95
R8423:Col20a1	UTSW	2	180998705	missense	probably damaging	1.00
R8803:Col20a1	UTSW	2	181001338	missense	possibly damaging	0.75
R8849:Col20a1	UTSW	2	180998639	missense	probably damaging	1.00
R8855:Col20a1	UTSW	2	181013891	missense
R8885:Col20a1	UTSW	2	180998503	splice site	probably benign
R9160:Col20a1	UTSW	2	180999745	missense	probably benign
R9223:Col20a1	UTSW	2	181006735	missense	probably damaging	1.00
R9697:Col20a1	UTSW	2	180999784	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTACTGAGGGTAGCAGCAG -3'
(R):5'- TGGTGCCTCACTGAATCTGG -3'

Sequencing Primer
(F):5'- CAGCTTCTTTGTGGAGGGAAAG -3'
(R):5'- CACTGAATCTGGGGTCTCACTG -3'

Posted On

2014-10-30