Mutagenetix > Incidental Mutation

Incidental Mutation 'R2343:Tnni3k'

245896

Institutional Source

Beutler Lab

Gene Symbol

Tnni3k

Ensembl Gene

ENSMUSG00000040086

Gene Name

TNNI3 interacting kinase

Synonyms

Cark, D830019J24Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R2343 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

154786291-155055407 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 154938829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 564 (I564T)

Ref Sequence

ENSEMBL: ENSMUSP00000122478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064076] [ENSMUST00000143410]

AlphaFold

Q5GIG6

Predicted Effect

probably benign
Transcript: ENSMUST00000064076
AA Change: I564T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000070561
Gene: ENSMUSG00000040086
AA Change: I564T

Domain	Start	End	E-Value	Type
coiled coil region	21	49	N/A	INTRINSIC
ANK	66	96	9.46e1	SMART
ANK	100	129	4.43e-2	SMART
ANK	133	162	3.15e-7	SMART
ANK	166	195	6.12e-5	SMART
ANK	199	229	1.65e-1	SMART
ANK	233	264	6.07e0	SMART
ANK	268	299	8.99e-3	SMART
ANK	303	334	1.19e-2	SMART
ANK	338	367	7.76e-7	SMART
ANK	380	409	2.43e1	SMART
Pfam:Pkinase	462	718	6.7e-48	PFAM
Pfam:Pkinase_Tyr	462	718	2.1e-59	PFAM
low complexity region	727	750	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143410
AA Change: I564T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000122478
Gene: ENSMUSG00000040086
AA Change: I564T

Domain	Start	End	E-Value	Type
coiled coil region	21	49	N/A	INTRINSIC
ANK	66	96	9.46e1	SMART
ANK	100	129	4.43e-2	SMART
ANK	133	162	3.15e-7	SMART
ANK	166	195	6.12e-5	SMART
ANK	199	229	1.65e-1	SMART
ANK	233	264	6.07e0	SMART
ANK	268	299	8.99e-3	SMART
ANK	303	334	1.19e-2	SMART
ANK	338	367	7.76e-7	SMART
ANK	380	409	2.43e1	SMART
Pfam:Pkinase	462	674	3.5e-48	PFAM
Pfam:Pkinase_Tyr	462	674	3.6e-52	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac myocytes exhibit decreased response to cardiac ischemic/reperfusion injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcr	T	C	10: 75,145,422	I691T	probably benign	Het
Col20a1	A	G	2: 181,001,331	T865A	possibly damaging	Het
Dmxl1	G	A	18: 49,890,678	R1676H	probably damaging	Het
Dsg2	T	C	18: 20,602,298	V1111A	probably damaging	Het
Eif3g	T	C	9: 20,895,154	Y213C	probably damaging	Het
Fat4	C	T	3: 38,957,105	S2118F	probably damaging	Het
Gpr85	A	G	6: 13,836,696	S70P	probably damaging	Het
Krtap31-1	A	C	11: 99,908,021	T17P	possibly damaging	Het
Lig1	A	G	7: 13,292,195		probably null	Het
Lman2l	A	T	1: 36,428,109	D269E	possibly damaging	Het
Mcc	A	G	18: 44,459,797		probably null	Het
Nav2	T	C	7: 49,598,817	F2302L	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1282	A	G	2: 111,335,700	I126T	probably damaging	Het
Olfr1342	C	A	4: 118,690,187	M88I	probably benign	Het
Sema6c	T	C	3: 95,167,083	F67L	probably damaging	Het
Sez6l	A	T	5: 112,464,731	V448D	probably damaging	Het
Smoc2	A	G	17: 14,344,342	K160R	probably benign	Het
Spata2	A	T	2: 167,483,360	V513E	probably damaging	Het
Susd3	T	A	13: 49,238,859	M107L	probably damaging	Het
Zfp971	A	G	2: 178,032,994	K129E	possibly damaging	Het

Other mutations in Tnni3k

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Tnni3k	APN	3	155054555	missense	probably benign	0.00
IGL00852:Tnni3k	APN	3	155054569	missense	probably benign	0.00
IGL01090:Tnni3k	APN	3	154939683	missense	possibly damaging	0.69
IGL01593:Tnni3k	APN	3	154941029	splice site	probably null
IGL01724:Tnni3k	APN	3	154939626	missense	possibly damaging	0.53
IGL01887:Tnni3k	APN	3	154875187	splice site	probably null
IGL01992:Tnni3k	APN	3	154962026	missense	probably damaging	0.99
IGL02945:Tnni3k	APN	3	155037438	missense	possibly damaging	0.48
IGL02990:Tnni3k	APN	3	154957758	missense	probably benign	0.01
IGL03069:Tnni3k	APN	3	154941605	splice site	probably null
IGL03325:Tnni3k	APN	3	154961814	missense	probably damaging	1.00
IGL03405:Tnni3k	APN	3	154792767	splice site	probably benign
R0211:Tnni3k	UTSW	3	155055344	start gained	probably benign
R0682:Tnni3k	UTSW	3	154940028	missense	probably damaging	1.00
R0693:Tnni3k	UTSW	3	154961972	missense	probably damaging	1.00
R0907:Tnni3k	UTSW	3	154941679	missense	probably damaging	1.00
R1109:Tnni3k	UTSW	3	154792777	missense	possibly damaging	0.83
R1180:Tnni3k	UTSW	3	154875513	missense	probably damaging	1.00
R1181:Tnni3k	UTSW	3	154875513	missense	probably damaging	1.00
R1476:Tnni3k	UTSW	3	155030305	missense	probably benign	0.05
R1496:Tnni3k	UTSW	3	154939658	missense	probably damaging	1.00
R1687:Tnni3k	UTSW	3	154939626	missense	possibly damaging	0.53
R1704:Tnni3k	UTSW	3	154827508	missense	probably benign	0.27
R1913:Tnni3k	UTSW	3	154979199	missense	probably benign	0.00
R2374:Tnni3k	UTSW	3	154786785	missense	probably benign	0.12
R2869:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2869:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2871:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2871:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2872:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2872:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2873:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R4858:Tnni3k	UTSW	3	154786808	splice site	probably null
R5597:Tnni3k	UTSW	3	154872128	missense	probably damaging	1.00
R5806:Tnni3k	UTSW	3	154827611	missense	possibly damaging	0.88
R5871:Tnni3k	UTSW	3	155030370	missense	probably benign	0.23
R6467:Tnni3k	UTSW	3	154969285	missense	probably damaging	0.97
R6475:Tnni3k	UTSW	3	154941058	nonsense	probably null
R6882:Tnni3k	UTSW	3	154957720	missense	possibly damaging	0.49
R6976:Tnni3k	UTSW	3	154792776	missense	probably benign	0.14
R6986:Tnni3k	UTSW	3	154961864	missense	probably damaging	1.00
R7207:Tnni3k	UTSW	3	154875145	missense	probably damaging	1.00
R7539:Tnni3k	UTSW	3	154962031	missense	probably benign	0.01
R7843:Tnni3k	UTSW	3	155038524	missense	probably damaging	0.98
R8546:Tnni3k	UTSW	3	154792807	missense	probably benign
R8787:Tnni3k	UTSW	3	154940054	missense	probably damaging	0.99
R9011:Tnni3k	UTSW	3	154856549	missense	probably damaging	1.00
R9031:Tnni3k	UTSW	3	155038509	missense	probably damaging	1.00
R9098:Tnni3k	UTSW	3	154941677	missense	possibly damaging	0.67
R9616:Tnni3k	UTSW	3	154962087	nonsense	probably null
R9655:Tnni3k	UTSW	3	154939773	nonsense	probably null
R9733:Tnni3k	UTSW	3	154856607	missense	probably damaging	1.00
Z1088:Tnni3k	UTSW	3	154939670	missense	probably damaging	1.00
Z1176:Tnni3k	UTSW	3	155038557	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCTACGAGACCATGGCAG -3'
(R):5'- TCCAGACTGAACATTTAACTCCATC -3'

Sequencing Primer
(F):5'- CCTTTCCACAGTGTGCATAGAG -3'
(R):5'- GAACATTTAACTCCATCTTCAATGTG -3'

Posted On

2014-10-30