Incidental Mutation 'R2343:Tnni3k'
ID 245896
Institutional Source Beutler Lab
Gene Symbol Tnni3k
Ensembl Gene ENSMUSG00000040086
Gene Name TNNI3 interacting kinase
Synonyms Cark, D830019J24Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.254) question?
Stock # R2343 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 154491928-154761044 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 154644466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 564 (I564T)
Ref Sequence ENSEMBL: ENSMUSP00000122478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064076] [ENSMUST00000143410]
AlphaFold Q5GIG6
Predicted Effect probably benign
Transcript: ENSMUST00000064076
AA Change: I564T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000070561
Gene: ENSMUSG00000040086
AA Change: I564T

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 718 6.7e-48 PFAM
Pfam:Pkinase_Tyr 462 718 2.1e-59 PFAM
low complexity region 727 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143410
AA Change: I564T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122478
Gene: ENSMUSG00000040086
AA Change: I564T

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 674 3.5e-48 PFAM
Pfam:Pkinase_Tyr 462 674 3.6e-52 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac myocytes exhibit decreased response to cardiac ischemic/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 74,981,254 (GRCm39) I691T probably benign Het
Col20a1 A G 2: 180,643,124 (GRCm39) T865A possibly damaging Het
Dmxl1 G A 18: 50,023,745 (GRCm39) R1676H probably damaging Het
Dsg2 T C 18: 20,735,355 (GRCm39) V1111A probably damaging Het
Eif3g T C 9: 20,806,450 (GRCm39) Y213C probably damaging Het
Fat4 C T 3: 39,011,254 (GRCm39) S2118F probably damaging Het
Gpr85 A G 6: 13,836,695 (GRCm39) S70P probably damaging Het
Krtap31-1 A C 11: 99,798,847 (GRCm39) T17P possibly damaging Het
Lig1 A G 7: 13,026,121 (GRCm39) probably null Het
Lman2l A T 1: 36,467,190 (GRCm39) D269E possibly damaging Het
Mcc A G 18: 44,592,864 (GRCm39) probably null Het
Nav2 T C 7: 49,248,565 (GRCm39) F2302L possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or13p4 C A 4: 118,547,384 (GRCm39) M88I probably benign Het
Or4k38 A G 2: 111,166,045 (GRCm39) I126T probably damaging Het
Sema6c T C 3: 95,074,394 (GRCm39) F67L probably damaging Het
Sez6l A T 5: 112,612,597 (GRCm39) V448D probably damaging Het
Smoc2 A G 17: 14,564,604 (GRCm39) K160R probably benign Het
Spata2 A T 2: 167,325,280 (GRCm39) V513E probably damaging Het
Susd3 T A 13: 49,392,335 (GRCm39) M107L probably damaging Het
Zfp971 A G 2: 177,674,787 (GRCm39) K129E possibly damaging Het
Other mutations in Tnni3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Tnni3k APN 3 154,760,192 (GRCm39) missense probably benign 0.00
IGL00852:Tnni3k APN 3 154,760,206 (GRCm39) missense probably benign 0.00
IGL01090:Tnni3k APN 3 154,645,320 (GRCm39) missense possibly damaging 0.69
IGL01593:Tnni3k APN 3 154,646,666 (GRCm39) splice site probably null
IGL01724:Tnni3k APN 3 154,645,263 (GRCm39) missense possibly damaging 0.53
IGL01887:Tnni3k APN 3 154,580,824 (GRCm39) splice site probably null
IGL01992:Tnni3k APN 3 154,667,663 (GRCm39) missense probably damaging 0.99
IGL02945:Tnni3k APN 3 154,743,075 (GRCm39) missense possibly damaging 0.48
IGL02990:Tnni3k APN 3 154,663,395 (GRCm39) missense probably benign 0.01
IGL03069:Tnni3k APN 3 154,647,242 (GRCm39) splice site probably null
IGL03325:Tnni3k APN 3 154,667,451 (GRCm39) missense probably damaging 1.00
IGL03405:Tnni3k APN 3 154,498,404 (GRCm39) splice site probably benign
R0211:Tnni3k UTSW 3 154,760,981 (GRCm39) start gained probably benign
R0682:Tnni3k UTSW 3 154,645,665 (GRCm39) missense probably damaging 1.00
R0693:Tnni3k UTSW 3 154,667,609 (GRCm39) missense probably damaging 1.00
R0907:Tnni3k UTSW 3 154,647,316 (GRCm39) missense probably damaging 1.00
R1109:Tnni3k UTSW 3 154,498,414 (GRCm39) missense possibly damaging 0.83
R1180:Tnni3k UTSW 3 154,581,150 (GRCm39) missense probably damaging 1.00
R1181:Tnni3k UTSW 3 154,581,150 (GRCm39) missense probably damaging 1.00
R1476:Tnni3k UTSW 3 154,735,942 (GRCm39) missense probably benign 0.05
R1496:Tnni3k UTSW 3 154,645,295 (GRCm39) missense probably damaging 1.00
R1687:Tnni3k UTSW 3 154,645,263 (GRCm39) missense possibly damaging 0.53
R1704:Tnni3k UTSW 3 154,533,145 (GRCm39) missense probably benign 0.27
R1913:Tnni3k UTSW 3 154,684,836 (GRCm39) missense probably benign 0.00
R2374:Tnni3k UTSW 3 154,492,422 (GRCm39) missense probably benign 0.12
R2869:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2869:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2871:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2871:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2872:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2872:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2873:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R4858:Tnni3k UTSW 3 154,492,445 (GRCm39) splice site probably null
R5597:Tnni3k UTSW 3 154,577,765 (GRCm39) missense probably damaging 1.00
R5806:Tnni3k UTSW 3 154,533,248 (GRCm39) missense possibly damaging 0.88
R5871:Tnni3k UTSW 3 154,736,007 (GRCm39) missense probably benign 0.23
R6467:Tnni3k UTSW 3 154,674,922 (GRCm39) missense probably damaging 0.97
R6475:Tnni3k UTSW 3 154,646,695 (GRCm39) nonsense probably null
R6882:Tnni3k UTSW 3 154,663,357 (GRCm39) missense possibly damaging 0.49
R6976:Tnni3k UTSW 3 154,498,413 (GRCm39) missense probably benign 0.14
R6986:Tnni3k UTSW 3 154,667,501 (GRCm39) missense probably damaging 1.00
R7207:Tnni3k UTSW 3 154,580,782 (GRCm39) missense probably damaging 1.00
R7539:Tnni3k UTSW 3 154,667,668 (GRCm39) missense probably benign 0.01
R7843:Tnni3k UTSW 3 154,744,161 (GRCm39) missense probably damaging 0.98
R8546:Tnni3k UTSW 3 154,498,444 (GRCm39) missense probably benign
R8787:Tnni3k UTSW 3 154,645,691 (GRCm39) missense probably damaging 0.99
R9011:Tnni3k UTSW 3 154,562,186 (GRCm39) missense probably damaging 1.00
R9031:Tnni3k UTSW 3 154,744,146 (GRCm39) missense probably damaging 1.00
R9098:Tnni3k UTSW 3 154,647,314 (GRCm39) missense possibly damaging 0.67
R9616:Tnni3k UTSW 3 154,667,724 (GRCm39) nonsense probably null
R9655:Tnni3k UTSW 3 154,645,410 (GRCm39) nonsense probably null
R9733:Tnni3k UTSW 3 154,562,244 (GRCm39) missense probably damaging 1.00
Z1088:Tnni3k UTSW 3 154,645,307 (GRCm39) missense probably damaging 1.00
Z1176:Tnni3k UTSW 3 154,744,194 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCTACGAGACCATGGCAG -3'
(R):5'- TCCAGACTGAACATTTAACTCCATC -3'

Sequencing Primer
(F):5'- CCTTTCCACAGTGTGCATAGAG -3'
(R):5'- GAACATTTAACTCCATCTTCAATGTG -3'
Posted On 2014-10-30