Incidental Mutation 'R2343:Sez6l'
ID 245898
Institutional Source Beutler Lab
Gene Symbol Sez6l
Ensembl Gene ENSMUSG00000058153
Gene Name seizure related 6 homolog like
Synonyms Acig1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2343 (G1)
Quality Score 183
Status Not validated
Chromosome 5
Chromosomal Location 112419151-112577185 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112464731 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 448 (V448D)
Ref Sequence ENSEMBL: ENSMUSP00000148791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075387] [ENSMUST00000079491] [ENSMUST00000197425] [ENSMUST00000212480] [ENSMUST00000212758]
AlphaFold Q6P1D5
Predicted Effect probably damaging
Transcript: ENSMUST00000075387
AA Change: V448D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074847
Gene: ENSMUSG00000058153
AA Change: V448D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 880 891 N/A INTRINSIC
transmembrane domain 895 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079491
AA Change: V448D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078454
Gene: ENSMUSG00000058153
AA Change: V448D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 878 892 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197425
AA Change: V448D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143395
Gene: ENSMUSG00000058153
AA Change: V448D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
low complexity region 815 826 N/A INTRINSIC
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200575
AA Change: V262D
Predicted Effect probably damaging
Transcript: ENSMUST00000212480
AA Change: V448D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000212758
AA Change: V448D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display slightly impaired coordination in the rotarod task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 75,145,422 I691T probably benign Het
Col20a1 A G 2: 181,001,331 T865A possibly damaging Het
Dmxl1 G A 18: 49,890,678 R1676H probably damaging Het
Dsg2 T C 18: 20,602,298 V1111A probably damaging Het
Eif3g T C 9: 20,895,154 Y213C probably damaging Het
Fat4 C T 3: 38,957,105 S2118F probably damaging Het
Gpr85 A G 6: 13,836,696 S70P probably damaging Het
Krtap31-1 A C 11: 99,908,021 T17P possibly damaging Het
Lig1 A G 7: 13,292,195 probably null Het
Lman2l A T 1: 36,428,109 D269E possibly damaging Het
Mcc A G 18: 44,459,797 probably null Het
Nav2 T C 7: 49,598,817 F2302L possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1282 A G 2: 111,335,700 I126T probably damaging Het
Olfr1342 C A 4: 118,690,187 M88I probably benign Het
Sema6c T C 3: 95,167,083 F67L probably damaging Het
Smoc2 A G 17: 14,344,342 K160R probably benign Het
Spata2 A T 2: 167,483,360 V513E probably damaging Het
Susd3 T A 13: 49,238,859 M107L probably damaging Het
Tnni3k A G 3: 154,938,829 I564T probably benign Het
Zfp971 A G 2: 178,032,994 K129E possibly damaging Het
Other mutations in Sez6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Sez6l APN 5 112424645 missense probably damaging 1.00
IGL00494:Sez6l APN 5 112463003 missense probably damaging 1.00
IGL00693:Sez6l APN 5 112422013 missense probably damaging 1.00
IGL01146:Sez6l APN 5 112428409 missense probably damaging 1.00
IGL01382:Sez6l APN 5 112425621 missense probably benign 0.00
IGL01393:Sez6l APN 5 112438395 splice site probably benign
IGL01961:Sez6l APN 5 112471731 missense probably damaging 1.00
IGL02101:Sez6l APN 5 112472746 missense probably damaging 1.00
IGL02104:Sez6l APN 5 112426764 intron probably benign
IGL02316:Sez6l APN 5 112462962 missense probably damaging 1.00
IGL02965:Sez6l APN 5 112475574 missense probably damaging 0.99
IGL03102:Sez6l APN 5 112475403 missense probably benign 0.02
IGL03112:Sez6l APN 5 112473467 missense probably damaging 1.00
IGL03180:Sez6l APN 5 112436285 missense probably damaging 1.00
ranger UTSW 5 112576812 splice site probably null
R0245:Sez6l UTSW 5 112475566 missense probably benign
R0662:Sez6l UTSW 5 112473422 missense probably damaging 1.00
R1227:Sez6l UTSW 5 112473464 missense probably damaging 1.00
R1605:Sez6l UTSW 5 112475049 missense probably damaging 1.00
R1873:Sez6l UTSW 5 112473410 splice site probably benign
R1878:Sez6l UTSW 5 112475223 missense probably damaging 0.98
R1892:Sez6l UTSW 5 112472799 missense probably damaging 1.00
R1961:Sez6l UTSW 5 112424615 splice site probably benign
R2038:Sez6l UTSW 5 112472752 missense possibly damaging 0.81
R2212:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R2315:Sez6l UTSW 5 112464597 missense probably benign 0.02
R3412:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3413:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3423:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R3425:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R4081:Sez6l UTSW 5 112461166 missense probably benign 0.01
R4574:Sez6l UTSW 5 112428478 missense probably damaging 1.00
R5792:Sez6l UTSW 5 112422024 nonsense probably null
R5864:Sez6l UTSW 5 112438400 critical splice donor site probably null
R6236:Sez6l UTSW 5 112475244 missense possibly damaging 0.86
R6274:Sez6l UTSW 5 112475365 nonsense probably null
R6466:Sez6l UTSW 5 112461141 splice site probably null
R6574:Sez6l UTSW 5 112576826 missense possibly damaging 0.89
R7008:Sez6l UTSW 5 112464695 missense probably damaging 1.00
R7241:Sez6l UTSW 5 112473480 missense probably benign
R7329:Sez6l UTSW 5 112440907 missense probably damaging 0.99
R7335:Sez6l UTSW 5 112576812 splice site probably null
R7502:Sez6l UTSW 5 112475481 missense possibly damaging 0.89
R7870:Sez6l UTSW 5 112438581 missense probably damaging 1.00
R8260:Sez6l UTSW 5 112461256 missense probably benign 0.23
R8325:Sez6l UTSW 5 112428116 splice site probably null
R8884:Sez6l UTSW 5 112475044 missense probably damaging 1.00
R8897:Sez6l UTSW 5 112440878 missense possibly damaging 0.94
R9071:Sez6l UTSW 5 112425737 splice site probably benign
R9142:Sez6l UTSW 5 112461217 missense probably benign 0.00
R9159:Sez6l UTSW 5 112465958 missense possibly damaging 0.52
X0052:Sez6l UTSW 5 112472901 missense possibly damaging 0.75
Z1088:Sez6l UTSW 5 112440915 missense probably damaging 1.00
Z1177:Sez6l UTSW 5 112576932 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATCCTAGACCCTGGTTCAGC -3'
(R):5'- AACAAGCAGACAGTTTCCATTTCTG -3'

Sequencing Primer
(F):5'- AGACCCTGGTTCAGCCTTCAC -3'
(R):5'- CAGACAGTTTCCATTTCTGTGACGG -3'
Posted On 2014-10-30