Incidental Mutation 'R2343:Gpr85'
ID 245899
Institutional Source Beutler Lab
Gene Symbol Gpr85
Ensembl Gene ENSMUSG00000048216
Gene Name G protein-coupled receptor 85
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R2343 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 13834458-13839942 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13836696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 70 (S70P)
Ref Sequence ENSEMBL: ENSMUSP00000111155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060442] [ENSMUST00000115491] [ENSMUST00000115492]
AlphaFold P60894
Predicted Effect probably damaging
Transcript: ENSMUST00000060442
AA Change: S70P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053837
Gene: ENSMUSG00000048216
AA Change: S70P

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115491
AA Change: S70P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111154
Gene: ENSMUSG00000048216
AA Change: S70P

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115492
AA Change: S70P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111155
Gene: ENSMUSG00000048216
AA Change: S70P

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 1.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127072
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the G protein-coupled receptor (GPCR) family, such as GPR85, have a similar structure characterized by 7 transmembrane domains. Activation of GPCRs by extracellular stimuli, such as neurotransmitters, hormones, or light, induces an intracellular signaling cascade mediated by heterotrimeric GTP-binding proteins, or G proteins (Matsumoto et al., 2000 [PubMed 10833454]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a significant increase in brain weight and enhanced contextual memory in a fear-conditioning task but no additional behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 75,145,422 I691T probably benign Het
Col20a1 A G 2: 181,001,331 T865A possibly damaging Het
Dmxl1 G A 18: 49,890,678 R1676H probably damaging Het
Dsg2 T C 18: 20,602,298 V1111A probably damaging Het
Eif3g T C 9: 20,895,154 Y213C probably damaging Het
Fat4 C T 3: 38,957,105 S2118F probably damaging Het
Krtap31-1 A C 11: 99,908,021 T17P possibly damaging Het
Lig1 A G 7: 13,292,195 probably null Het
Lman2l A T 1: 36,428,109 D269E possibly damaging Het
Mcc A G 18: 44,459,797 probably null Het
Nav2 T C 7: 49,598,817 F2302L possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1282 A G 2: 111,335,700 I126T probably damaging Het
Olfr1342 C A 4: 118,690,187 M88I probably benign Het
Sema6c T C 3: 95,167,083 F67L probably damaging Het
Sez6l A T 5: 112,464,731 V448D probably damaging Het
Smoc2 A G 17: 14,344,342 K160R probably benign Het
Spata2 A T 2: 167,483,360 V513E probably damaging Het
Susd3 T A 13: 49,238,859 M107L probably damaging Het
Tnni3k A G 3: 154,938,829 I564T probably benign Het
Zfp971 A G 2: 178,032,994 K129E possibly damaging Het
Other mutations in Gpr85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:Gpr85 APN 6 13836910 utr 5 prime probably benign
R0784:Gpr85 UTSW 6 13836749 missense probably benign 0.25
R1356:Gpr85 UTSW 6 13836147 missense probably benign 0.42
R3934:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R3935:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R3936:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R4925:Gpr85 UTSW 6 13835978 missense probably benign 0.26
R5313:Gpr85 UTSW 6 13836302 missense probably damaging 1.00
R5586:Gpr85 UTSW 6 13836001 nonsense probably null
R7043:Gpr85 UTSW 6 13835877 missense probably damaging 1.00
R8458:Gpr85 UTSW 6 13836849 missense probably benign
R8468:Gpr85 UTSW 6 13836296 missense probably damaging 1.00
R8503:Gpr85 UTSW 6 13836830 missense probably benign 0.01
R9519:Gpr85 UTSW 6 13836999 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAAAGGTCAGCCTCTTTG -3'
(R):5'- ACTATAGCCATGCAGCCGAC -3'

Sequencing Primer
(F):5'- AAGGTCAGCCTCTTTGTATAGAAGCG -3'
(R):5'- TGCAGCCGACAACATTTTG -3'
Posted On 2014-10-30