Incidental Mutation 'R2343:Lig1'
ID245900
Institutional Source Beutler Lab
Gene Symbol Lig1
Ensembl Gene ENSMUSG00000056394
Gene Nameligase I, DNA, ATP-dependent
SynonymsLigI, mLigI
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2343 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13277283-13311433 bp(+) (GRCm38)
Type of Mutationunclassified (678 bp from exon)
DNA Base Change (assembly) A to G at 13292195 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000123025] [ENSMUST00000146998] [ENSMUST00000165964] [ENSMUST00000177588] [ENSMUST00000185145]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098814
AA Change: D292G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394
AA Change: D292G

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123025
SMART Domains Protein: ENSMUSP00000114872
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 96 111 N/A INTRINSIC
low complexity region 159 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123846
SMART Domains Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146998
SMART Domains Protein: ENSMUSP00000121102
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
low complexity region 160 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147735
SMART Domains Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148471
SMART Domains Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156525
SMART Domains Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165964
AA Change: D292G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394
AA Change: D292G

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 302 478 1.7e-40 PFAM
Pfam:DNA_ligase_A_M 556 760 1.1e-69 PFAM
Pfam:DNA_ligase_A_C 785 896 1.6e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177588
AA Change: D292G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394
AA Change: D292G

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185145
AA Change: D292G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138907
Gene: ENSMUSG00000056394
AA Change: D292G

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
PDB:1X9N|A 247 313 3e-24 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired fetal hematopoiesis, develop anemia, and die by E16.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 75,145,422 I691T probably benign Het
Col20a1 A G 2: 181,001,331 T865A possibly damaging Het
Dmxl1 G A 18: 49,890,678 R1676H probably damaging Het
Dsg2 T C 18: 20,602,298 V1111A probably damaging Het
Eif3g T C 9: 20,895,154 Y213C probably damaging Het
Fat4 C T 3: 38,957,105 S2118F probably damaging Het
Gpr85 A G 6: 13,836,696 S70P probably damaging Het
Krtap31-1 A C 11: 99,908,021 T17P possibly damaging Het
Lman2l A T 1: 36,428,109 D269E possibly damaging Het
Mcc A G 18: 44,459,797 probably null Het
Nav2 T C 7: 49,598,817 F2302L possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1282 A G 2: 111,335,700 I126T probably damaging Het
Olfr1342 C A 4: 118,690,187 M88I probably benign Het
Sema6c T C 3: 95,167,083 F67L probably damaging Het
Sez6l A T 5: 112,464,731 V448D probably damaging Het
Smoc2 A G 17: 14,344,342 K160R probably benign Het
Spata2 A T 2: 167,483,360 V513E probably damaging Het
Susd3 T A 13: 49,238,859 M107L probably damaging Het
Tnni3k A G 3: 154,938,829 I564T probably benign Het
Zfp971 A G 2: 178,032,994 K129E possibly damaging Het
Other mutations in Lig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Lig1 APN 7 13301452 nonsense probably null
IGL00499:Lig1 APN 7 13298830 critical splice donor site probably null
IGL01465:Lig1 APN 7 13296391 missense probably benign 0.19
IGL01804:Lig1 APN 7 13309206 missense probably benign 0.43
IGL02068:Lig1 APN 7 13292451 splice site probably benign
IGL02955:Lig1 APN 7 13296347 missense probably damaging 0.99
IGL03188:Lig1 APN 7 13311107 splice site probably benign
IGL03327:Lig1 APN 7 13303855 missense probably damaging 1.00
IGL03411:Lig1 APN 7 13296768 missense probably damaging 1.00
PIT4142001:Lig1 UTSW 7 13305924 frame shift probably null
R0085:Lig1 UTSW 7 13307570 missense possibly damaging 0.66
R0348:Lig1 UTSW 7 13309197 missense probably damaging 1.00
R0362:Lig1 UTSW 7 13296804 unclassified probably benign
R0787:Lig1 UTSW 7 13299069 missense probably benign 0.41
R1170:Lig1 UTSW 7 13292153 missense probably benign 0.00
R1371:Lig1 UTSW 7 13288685 missense probably damaging 1.00
R1610:Lig1 UTSW 7 13285340 missense probably damaging 1.00
R1809:Lig1 UTSW 7 13300355 splice site probably benign
R1986:Lig1 UTSW 7 13309142 nonsense probably null
R2106:Lig1 UTSW 7 13305938 missense probably damaging 1.00
R2380:Lig1 UTSW 7 13303796 splice site probably benign
R3545:Lig1 UTSW 7 13292163 missense possibly damaging 0.82
R4669:Lig1 UTSW 7 13311028 missense probably damaging 1.00
R4928:Lig1 UTSW 7 13298738 missense probably damaging 1.00
R5167:Lig1 UTSW 7 13311058 missense probably damaging 0.97
R5249:Lig1 UTSW 7 13308507 missense possibly damaging 0.60
R5351:Lig1 UTSW 7 13300949 missense probably damaging 1.00
R5373:Lig1 UTSW 7 13305923 frame shift probably null
R5607:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5608:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5620:Lig1 UTSW 7 13286606 missense possibly damaging 0.66
R5799:Lig1 UTSW 7 13296258 missense possibly damaging 0.67
R6057:Lig1 UTSW 7 13288672 missense probably damaging 0.99
R6897:Lig1 UTSW 7 13305914 missense probably damaging 1.00
R7202:Lig1 UTSW 7 13291249 missense probably benign 0.00
R7454:Lig1 UTSW 7 13288721 missense probably damaging 0.99
R7548:Lig1 UTSW 7 13301418 missense possibly damaging 0.79
R7596:Lig1 UTSW 7 13305998 missense probably damaging 1.00
R7597:Lig1 UTSW 7 13296344 missense probably benign
R7688:Lig1 UTSW 7 13289463 missense probably benign
R7733:Lig1 UTSW 7 13296231 missense possibly damaging 0.87
X0020:Lig1 UTSW 7 13296774 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTCTGTCAGCAGTGAGGAGATAG -3'
(R):5'- AACATCCTGTAGCCACCCTG -3'

Sequencing Primer
(F):5'- AGATAGGAATGTGTTAACCTTTGGC -3'
(R):5'- TTTCCTGAGATAAATGCAGAGGC -3'
Posted On2014-10-30