Incidental Mutation 'R2343:Eif3g'
ID 245903
Institutional Source Beutler Lab
Gene Symbol Eif3g
Ensembl Gene ENSMUSG00000070319
Gene Name eukaryotic translation initiation factor 3, subunit G
Synonyms 44kDa, D0Jmb4, Eif3s4, p44, TU-189B2
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R2343 (G1)
Quality Score 127
Status Not validated
Chromosome 9
Chromosomal Location 20805645-20809886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20806450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 213 (Y213C)
Ref Sequence ENSEMBL: ENSMUSP00000004206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004203] [ENSMUST00000004206] [ENSMUST00000214331]
AlphaFold Q9Z1D1
Predicted Effect probably benign
Transcript: ENSMUST00000004203
SMART Domains Protein: ENSMUSP00000004203
Gene: ENSMUSG00000004100

DomainStartEndE-ValueType
Brix 32 286 1.13e-77 SMART
Blast:Brix 321 429 6e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000004206
AA Change: Y213C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004206
Gene: ENSMUSG00000070319
AA Change: Y213C

DomainStartEndE-ValueType
Pfam:eIF3g 56 175 5.5e-45 PFAM
RRM 240 313 1.49e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213882
Predicted Effect probably benign
Transcript: ENSMUST00000214331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216133
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core subunit of the eukaryotic translation initiation factor 3 (eIF3) complex, which is required for initiation of protein translation. An N-terminal caspase cleavage product of the encoded protein may stimulate degradation of DNA. A mutation in this gene is associated with narcolepsy. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 74,981,254 (GRCm39) I691T probably benign Het
Col20a1 A G 2: 180,643,124 (GRCm39) T865A possibly damaging Het
Dmxl1 G A 18: 50,023,745 (GRCm39) R1676H probably damaging Het
Dsg2 T C 18: 20,735,355 (GRCm39) V1111A probably damaging Het
Fat4 C T 3: 39,011,254 (GRCm39) S2118F probably damaging Het
Gpr85 A G 6: 13,836,695 (GRCm39) S70P probably damaging Het
Krtap31-1 A C 11: 99,798,847 (GRCm39) T17P possibly damaging Het
Lig1 A G 7: 13,026,121 (GRCm39) probably null Het
Lman2l A T 1: 36,467,190 (GRCm39) D269E possibly damaging Het
Mcc A G 18: 44,592,864 (GRCm39) probably null Het
Nav2 T C 7: 49,248,565 (GRCm39) F2302L possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or13p4 C A 4: 118,547,384 (GRCm39) M88I probably benign Het
Or4k38 A G 2: 111,166,045 (GRCm39) I126T probably damaging Het
Sema6c T C 3: 95,074,394 (GRCm39) F67L probably damaging Het
Sez6l A T 5: 112,612,597 (GRCm39) V448D probably damaging Het
Smoc2 A G 17: 14,564,604 (GRCm39) K160R probably benign Het
Spata2 A T 2: 167,325,280 (GRCm39) V513E probably damaging Het
Susd3 T A 13: 49,392,335 (GRCm39) M107L probably damaging Het
Tnni3k A G 3: 154,644,466 (GRCm39) I564T probably benign Het
Zfp971 A G 2: 177,674,787 (GRCm39) K129E possibly damaging Het
Other mutations in Eif3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03373:Eif3g APN 9 20,805,722 (GRCm39) unclassified probably benign
R0076:Eif3g UTSW 9 20,809,049 (GRCm39) missense probably damaging 0.98
R0076:Eif3g UTSW 9 20,809,049 (GRCm39) missense probably damaging 0.98
R0332:Eif3g UTSW 9 20,809,280 (GRCm39) splice site probably benign
R3746:Eif3g UTSW 9 20,805,993 (GRCm39) missense probably benign 0.04
R4087:Eif3g UTSW 9 20,809,248 (GRCm39) missense possibly damaging 0.56
R4151:Eif3g UTSW 9 20,806,429 (GRCm39) missense probably benign 0.03
R8175:Eif3g UTSW 9 20,809,026 (GRCm39) missense probably damaging 0.98
R8530:Eif3g UTSW 9 20,809,026 (GRCm39) missense possibly damaging 0.71
R9025:Eif3g UTSW 9 20,807,426 (GRCm39) missense probably benign 0.12
R9522:Eif3g UTSW 9 20,809,452 (GRCm39) missense probably benign
R9522:Eif3g UTSW 9 20,809,451 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGGACAGGTTAGTGACACG -3'
(R):5'- ACTTTGCTCGTGACACTAGCAG -3'

Sequencing Primer
(F):5'- CACGGATGGTGGCATTGTC -3'
(R):5'- CTCGTGACACTAGCAGAGACTTTG -3'
Posted On 2014-10-30