Incidental Mutation 'R2343:Bcr'
ID 245904
Institutional Source Beutler Lab
Gene Symbol Bcr
Ensembl Gene ENSMUSG00000009681
Gene Name BCR activator of RhoGEF and GTPase
Synonyms breakpoint cluster region, 5133400C09Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R2343 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 74896424-75020753 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74981254 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 691 (I691T)
Ref Sequence ENSEMBL: ENSMUSP00000126377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164107]
AlphaFold Q6PAJ1
Predicted Effect probably benign
Transcript: ENSMUST00000164107
AA Change: I691T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126377
Gene: ENSMUSG00000009681
AA Change: I691T

DomainStartEndE-ValueType
Pfam:Bcr-Abl_Oligo 3 75 1.2e-44 PFAM
low complexity region 86 109 N/A INTRINSIC
low complexity region 121 147 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
RhoGEF 501 689 6.22e-51 SMART
PH 708 867 7.95e-8 SMART
C2 911 1016 2.85e-11 SMART
RhoGAP 1064 1248 6.42e-70 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A reciprocal translocation between chromosomes 22 and 9 produces the Philadelphia chromosome, which is often found in patients with chronic myelogenous leukemia. The chromosome 22 breakpoint for this translocation is located within the BCR gene. The translocation produces a fusion protein which is encoded by sequence from both BCR and ABL, the gene at the chromosome 9 breakpoint. Although the BCR-ABL fusion protein has been extensively studied, the function of the normal BCR gene product is not clear. The protein has serine/threonine kinase activity and is a GTPase-activating protein for p21rac. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are defective in hormonal and behavioral stress response regulation and prone to septic shock, whereas chimeric mice carrying a BCR-ABL fusion mutation mimicking human Philadelphia chromosome develop chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Col20a1 A G 2: 180,643,124 (GRCm39) T865A possibly damaging Het
Dmxl1 G A 18: 50,023,745 (GRCm39) R1676H probably damaging Het
Dsg2 T C 18: 20,735,355 (GRCm39) V1111A probably damaging Het
Eif3g T C 9: 20,806,450 (GRCm39) Y213C probably damaging Het
Fat4 C T 3: 39,011,254 (GRCm39) S2118F probably damaging Het
Gpr85 A G 6: 13,836,695 (GRCm39) S70P probably damaging Het
Krtap31-1 A C 11: 99,798,847 (GRCm39) T17P possibly damaging Het
Lig1 A G 7: 13,026,121 (GRCm39) probably null Het
Lman2l A T 1: 36,467,190 (GRCm39) D269E possibly damaging Het
Mcc A G 18: 44,592,864 (GRCm39) probably null Het
Nav2 T C 7: 49,248,565 (GRCm39) F2302L possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or13p4 C A 4: 118,547,384 (GRCm39) M88I probably benign Het
Or4k38 A G 2: 111,166,045 (GRCm39) I126T probably damaging Het
Sema6c T C 3: 95,074,394 (GRCm39) F67L probably damaging Het
Sez6l A T 5: 112,612,597 (GRCm39) V448D probably damaging Het
Smoc2 A G 17: 14,564,604 (GRCm39) K160R probably benign Het
Spata2 A T 2: 167,325,280 (GRCm39) V513E probably damaging Het
Susd3 T A 13: 49,392,335 (GRCm39) M107L probably damaging Het
Tnni3k A G 3: 154,644,466 (GRCm39) I564T probably benign Het
Zfp971 A G 2: 177,674,787 (GRCm39) K129E possibly damaging Het
Other mutations in Bcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bcr APN 10 74,992,903 (GRCm39) unclassified probably benign
IGL00662:Bcr APN 10 75,003,932 (GRCm39) splice site probably benign
IGL01359:Bcr APN 10 74,995,611 (GRCm39) unclassified probably benign
IGL01737:Bcr APN 10 74,990,783 (GRCm39) missense probably damaging 0.99
IGL01908:Bcr APN 10 74,897,705 (GRCm39) missense possibly damaging 0.85
IGL01954:Bcr APN 10 75,011,173 (GRCm39) splice site probably null
IGL02169:Bcr APN 10 74,995,714 (GRCm39) missense probably benign 0.07
IGL02379:Bcr APN 10 74,992,980 (GRCm39) missense probably benign 0.02
IGL02380:Bcr APN 10 75,011,131 (GRCm39) missense probably benign
IGL02385:Bcr APN 10 74,981,235 (GRCm39) missense probably damaging 1.00
IGL02657:Bcr APN 10 74,990,796 (GRCm39) missense probably benign 0.00
IGL02682:Bcr APN 10 75,001,878 (GRCm39) missense possibly damaging 0.67
IGL02959:Bcr APN 10 74,996,222 (GRCm39) missense probably benign 0.44
accrual UTSW 10 74,897,338 (GRCm39) missense possibly damaging 0.77
Appreciation UTSW 10 74,896,957 (GRCm39) nonsense probably null
R0329:Bcr UTSW 10 75,017,466 (GRCm39) missense possibly damaging 0.88
R0330:Bcr UTSW 10 75,017,466 (GRCm39) missense possibly damaging 0.88
R0376:Bcr UTSW 10 74,981,159 (GRCm39) missense probably damaging 1.00
R0685:Bcr UTSW 10 74,967,475 (GRCm39) missense probably damaging 1.00
R0828:Bcr UTSW 10 74,993,039 (GRCm39) unclassified probably benign
R0892:Bcr UTSW 10 74,960,895 (GRCm39) missense probably benign 0.00
R1143:Bcr UTSW 10 74,897,197 (GRCm39) missense probably benign 0.00
R1416:Bcr UTSW 10 74,897,338 (GRCm39) missense possibly damaging 0.77
R1479:Bcr UTSW 10 74,896,957 (GRCm39) nonsense probably null
R1611:Bcr UTSW 10 74,961,034 (GRCm39) splice site probably null
R1636:Bcr UTSW 10 74,966,898 (GRCm39) missense probably damaging 1.00
R1837:Bcr UTSW 10 75,003,932 (GRCm39) splice site probably benign
R2341:Bcr UTSW 10 74,966,944 (GRCm39) missense probably damaging 1.00
R3753:Bcr UTSW 10 74,971,772 (GRCm39) missense probably benign 0.05
R4273:Bcr UTSW 10 74,960,943 (GRCm39) missense probably damaging 0.97
R4624:Bcr UTSW 10 74,989,752 (GRCm39) missense probably damaging 1.00
R4723:Bcr UTSW 10 75,011,161 (GRCm39) missense probably benign 0.45
R5013:Bcr UTSW 10 74,960,898 (GRCm39) missense probably benign 0.00
R5359:Bcr UTSW 10 75,001,917 (GRCm39) missense probably damaging 0.99
R5458:Bcr UTSW 10 74,990,792 (GRCm39) missense probably benign
R5982:Bcr UTSW 10 75,012,248 (GRCm39) missense probably benign 0.08
R5988:Bcr UTSW 10 75,011,167 (GRCm39) missense probably benign 0.01
R6220:Bcr UTSW 10 74,898,124 (GRCm39) missense probably benign
R6827:Bcr UTSW 10 74,966,896 (GRCm39) missense probably damaging 1.00
R6886:Bcr UTSW 10 74,989,769 (GRCm39) missense probably damaging 1.00
R6990:Bcr UTSW 10 74,966,868 (GRCm39) missense possibly damaging 0.80
R7003:Bcr UTSW 10 74,897,393 (GRCm39) missense probably benign 0.08
R7424:Bcr UTSW 10 74,992,932 (GRCm39) missense probably benign
R7443:Bcr UTSW 10 74,978,968 (GRCm39) critical splice donor site probably null
R7488:Bcr UTSW 10 74,996,162 (GRCm39) missense possibly damaging 0.80
R8232:Bcr UTSW 10 75,001,883 (GRCm39) missense probably damaging 1.00
R8360:Bcr UTSW 10 74,981,271 (GRCm39) missense probably damaging 0.96
R8992:Bcr UTSW 10 74,967,404 (GRCm39) missense probably damaging 1.00
R9362:Bcr UTSW 10 74,993,023 (GRCm39) missense probably benign 0.19
R9487:Bcr UTSW 10 74,967,431 (GRCm39) missense probably damaging 1.00
R9610:Bcr UTSW 10 74,990,745 (GRCm39) nonsense probably null
R9610:Bcr UTSW 10 74,990,743 (GRCm39) missense probably damaging 1.00
R9611:Bcr UTSW 10 74,990,745 (GRCm39) nonsense probably null
R9611:Bcr UTSW 10 74,990,743 (GRCm39) missense probably damaging 1.00
R9630:Bcr UTSW 10 74,966,950 (GRCm39) missense probably damaging 1.00
R9662:Bcr UTSW 10 75,011,152 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTAGTAGGCCTGCAGCTC -3'
(R):5'- ACAGGAGCACCGTTCTTTCTAC -3'

Sequencing Primer
(F):5'- ACTCCGTGTGACAGGATTG -3'
(R):5'- AGGAGCACCGTTCTTTCTACTTTAC -3'
Posted On 2014-10-30