Incidental Mutation 'R2343:Susd3'
ID 245908
Institutional Source Beutler Lab
Gene Symbol Susd3
Ensembl Gene ENSMUSG00000021384
Gene Name sushi domain containing 3
Synonyms 1700017I11Rik, 2810440J20Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R2343 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 49384166-49402182 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49392335 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 107 (M107L)
Ref Sequence ENSEMBL: ENSMUSP00000021816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021816] [ENSMUST00000058196] [ENSMUST00000119721] [ENSMUST00000135784]
AlphaFold Q9D176
Predicted Effect probably damaging
Transcript: ENSMUST00000021816
AA Change: M107L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021816
Gene: ENSMUSG00000021384
AA Change: M107L

DomainStartEndE-ValueType
CCP 20 79 2.11e-9 SMART
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 154 179 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058196
AA Change: M119L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061423
Gene: ENSMUSG00000021384
AA Change: M119L

DomainStartEndE-ValueType
CCP 32 91 2.11e-9 SMART
transmembrane domain 107 129 N/A INTRINSIC
low complexity region 166 191 N/A INTRINSIC
low complexity region 230 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119721
AA Change: M119L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113631
Gene: ENSMUSG00000021384
AA Change: M119L

DomainStartEndE-ValueType
CCP 32 91 2.11e-9 SMART
transmembrane domain 107 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131880
Predicted Effect possibly damaging
Transcript: ENSMUST00000135784
AA Change: M44L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115888
Gene: ENSMUSG00000021384
AA Change: M44L

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
low complexity region 91 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141408
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 74,981,254 (GRCm39) I691T probably benign Het
Col20a1 A G 2: 180,643,124 (GRCm39) T865A possibly damaging Het
Dmxl1 G A 18: 50,023,745 (GRCm39) R1676H probably damaging Het
Dsg2 T C 18: 20,735,355 (GRCm39) V1111A probably damaging Het
Eif3g T C 9: 20,806,450 (GRCm39) Y213C probably damaging Het
Fat4 C T 3: 39,011,254 (GRCm39) S2118F probably damaging Het
Gpr85 A G 6: 13,836,695 (GRCm39) S70P probably damaging Het
Krtap31-1 A C 11: 99,798,847 (GRCm39) T17P possibly damaging Het
Lig1 A G 7: 13,026,121 (GRCm39) probably null Het
Lman2l A T 1: 36,467,190 (GRCm39) D269E possibly damaging Het
Mcc A G 18: 44,592,864 (GRCm39) probably null Het
Nav2 T C 7: 49,248,565 (GRCm39) F2302L possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or13p4 C A 4: 118,547,384 (GRCm39) M88I probably benign Het
Or4k38 A G 2: 111,166,045 (GRCm39) I126T probably damaging Het
Sema6c T C 3: 95,074,394 (GRCm39) F67L probably damaging Het
Sez6l A T 5: 112,612,597 (GRCm39) V448D probably damaging Het
Smoc2 A G 17: 14,564,604 (GRCm39) K160R probably benign Het
Spata2 A T 2: 167,325,280 (GRCm39) V513E probably damaging Het
Tnni3k A G 3: 154,644,466 (GRCm39) I564T probably benign Het
Zfp971 A G 2: 177,674,787 (GRCm39) K129E possibly damaging Het
Other mutations in Susd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Susd3 APN 13 49,384,614 (GRCm39) makesense probably null
IGL03336:Susd3 APN 13 49,392,258 (GRCm39) missense probably benign 0.09
R2122:Susd3 UTSW 13 49,384,626 (GRCm39) missense probably damaging 1.00
R2923:Susd3 UTSW 13 49,401,945 (GRCm39) start codon destroyed probably null 0.95
R4591:Susd3 UTSW 13 49,384,736 (GRCm39) missense possibly damaging 0.57
R4661:Susd3 UTSW 13 49,384,778 (GRCm39) splice site probably null
R5006:Susd3 UTSW 13 49,392,181 (GRCm39) intron probably benign
R5841:Susd3 UTSW 13 49,392,202 (GRCm39) intron probably benign
R6285:Susd3 UTSW 13 49,390,997 (GRCm39) missense probably damaging 1.00
R6796:Susd3 UTSW 13 49,391,041 (GRCm39) frame shift probably null
R7193:Susd3 UTSW 13 49,384,679 (GRCm39) missense probably damaging 1.00
R7311:Susd3 UTSW 13 49,401,906 (GRCm39) missense probably benign 0.00
R7572:Susd3 UTSW 13 49,384,638 (GRCm39) missense probably benign 0.31
R7697:Susd3 UTSW 13 49,391,074 (GRCm39) missense probably damaging 1.00
R8239:Susd3 UTSW 13 49,384,731 (GRCm39) missense probably benign
R8479:Susd3 UTSW 13 49,390,952 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGCCTCAGAATCCCAGGAAC -3'
(R):5'- CACCAGAGCCTGAATGACTTCC -3'

Sequencing Primer
(F):5'- TCCCAGGAACAACATATGCATGAGG -3'
(R):5'- TGAATGACTTCCCCCAAAATGG -3'
Posted On 2014-10-30