Mutagenetix > Incidental Mutation

Incidental Mutation 'R2343:Susd3'

245908

Institutional Source

Beutler Lab

Gene Symbol

Susd3

Ensembl Gene

ENSMUSG00000021384

Gene Name

sushi domain containing 3

Synonyms

2810440J20Rik, 1700017I11Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.050) question?

Stock #

R2343 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49230690-49248706 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49238859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 107 (M107L)

Ref Sequence

ENSEMBL: ENSMUSP00000021816 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021816] [ENSMUST00000058196] [ENSMUST00000119721] [ENSMUST00000135784]

AlphaFold

Q9D176

Predicted Effect

probably damaging
Transcript: ENSMUST00000021816
AA Change: M107L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021816
Gene: ENSMUSG00000021384
AA Change: M107L

Domain	Start	End	E-Value	Type
CCP	20	79	2.11e-9	SMART
transmembrane domain	95	117	N/A	INTRINSIC
low complexity region	154	179	N/A	INTRINSIC
low complexity region	218	231	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000058196
AA Change: M119L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000061423
Gene: ENSMUSG00000021384
AA Change: M119L

Domain	Start	End	E-Value	Type
CCP	32	91	2.11e-9	SMART
transmembrane domain	107	129	N/A	INTRINSIC
low complexity region	166	191	N/A	INTRINSIC
low complexity region	230	243	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119721
AA Change: M119L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113631
Gene: ENSMUSG00000021384
AA Change: M119L

Domain	Start	End	E-Value	Type
CCP	32	91	2.11e-9	SMART
transmembrane domain	107	129	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131880

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135784
AA Change: M44L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115888
Gene: ENSMUSG00000021384
AA Change: M44L

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
low complexity region	91	116	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141408

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcr	T	C	10: 75,145,422	I691T	probably benign	Het
Col20a1	A	G	2: 181,001,331	T865A	possibly damaging	Het
Dmxl1	G	A	18: 49,890,678	R1676H	probably damaging	Het
Dsg2	T	C	18: 20,602,298	V1111A	probably damaging	Het
Eif3g	T	C	9: 20,895,154	Y213C	probably damaging	Het
Fat4	C	T	3: 38,957,105	S2118F	probably damaging	Het
Gpr85	A	G	6: 13,836,696	S70P	probably damaging	Het
Krtap31-1	A	C	11: 99,908,021	T17P	possibly damaging	Het
Lig1	A	G	7: 13,292,195		probably null	Het
Lman2l	A	T	1: 36,428,109	D269E	possibly damaging	Het
Mcc	A	G	18: 44,459,797		probably null	Het
Nav2	T	C	7: 49,598,817	F2302L	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1282	A	G	2: 111,335,700	I126T	probably damaging	Het
Olfr1342	C	A	4: 118,690,187	M88I	probably benign	Het
Sema6c	T	C	3: 95,167,083	F67L	probably damaging	Het
Sez6l	A	T	5: 112,464,731	V448D	probably damaging	Het
Smoc2	A	G	17: 14,344,342	K160R	probably benign	Het
Spata2	A	T	2: 167,483,360	V513E	probably damaging	Het
Tnni3k	A	G	3: 154,938,829	I564T	probably benign	Het
Zfp971	A	G	2: 178,032,994	K129E	possibly damaging	Het

Other mutations in Susd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Susd3	APN	13	49231138	makesense	probably null
IGL03336:Susd3	APN	13	49238782	missense	probably benign	0.09
R2122:Susd3	UTSW	13	49231150	missense	probably damaging	1.00
R2923:Susd3	UTSW	13	49248469	start codon destroyed	probably null	0.95
R4591:Susd3	UTSW	13	49231260	missense	possibly damaging	0.57
R4661:Susd3	UTSW	13	49231302	splice site	probably null
R5006:Susd3	UTSW	13	49238705	intron	probably benign
R5841:Susd3	UTSW	13	49238726	intron	probably benign
R6285:Susd3	UTSW	13	49237521	missense	probably damaging	1.00
R6796:Susd3	UTSW	13	49237565	frame shift	probably null
R7193:Susd3	UTSW	13	49231203	missense	probably damaging	1.00
R7311:Susd3	UTSW	13	49248430	missense	probably benign	0.00
R7572:Susd3	UTSW	13	49231162	missense	probably benign	0.31
R7697:Susd3	UTSW	13	49237598	missense	probably damaging	1.00
R8239:Susd3	UTSW	13	49231255	missense	probably benign
R8479:Susd3	UTSW	13	49237476	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TGCCTCAGAATCCCAGGAAC -3'
(R):5'- CACCAGAGCCTGAATGACTTCC -3'

Sequencing Primer
(F):5'- TCCCAGGAACAACATATGCATGAGG -3'
(R):5'- TGAATGACTTCCCCCAAAATGG -3'

Posted On

2014-10-30