Incidental Mutation 'R2343:Smoc2'
ID 245909
Institutional Source Beutler Lab
Gene Symbol Smoc2
Ensembl Gene ENSMUSG00000023886
Gene Name SPARC related modular calcium binding 2
Synonyms Smoc2l, 5430426J21Rik, 1700056C05Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2343 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 14279506-14404790 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14344342 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 160 (K160R)
Ref Sequence ENSEMBL: ENSMUSP00000024660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024660]
AlphaFold Q8CD91
Predicted Effect probably benign
Transcript: ENSMUST00000024660
AA Change: K160R

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024660
Gene: ENSMUSG00000023886
AA Change: K160R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 39 84 1.49e-12 SMART
TY 110 157 3.07e-14 SMART
low complexity region 166 177 N/A INTRINSIC
TY 237 285 3.34e-15 SMART
Pfam:SPARC_Ca_bdg 302 412 8.6e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPARC family (secreted protein acidic and rich in cysteine/osteonectin/BM-40), which are highly expressed during embryogenesis and wound healing. The gene product is a matricellular protein which promotes matrix assembly and can stimulate endothelial cell proliferation and migration, as well as angiogenic activity. Associated with pulmonary function, this secretory gene product contains a Kazal domain, two thymoglobulin type-1 domains, and two EF-hand calcium-binding domains. The encoded protein may serve as a target for controlling angiogenesis in tumor growth and myocardial ischemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for one KO allele exhibit protection from induced kidney fibrosis and reduced interstitial myofibroblast accumulation. Another KO allele leads to shortening and widening of the skull. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 75,145,422 I691T probably benign Het
Col20a1 A G 2: 181,001,331 T865A possibly damaging Het
Dmxl1 G A 18: 49,890,678 R1676H probably damaging Het
Dsg2 T C 18: 20,602,298 V1111A probably damaging Het
Eif3g T C 9: 20,895,154 Y213C probably damaging Het
Fat4 C T 3: 38,957,105 S2118F probably damaging Het
Gpr85 A G 6: 13,836,696 S70P probably damaging Het
Krtap31-1 A C 11: 99,908,021 T17P possibly damaging Het
Lig1 A G 7: 13,292,195 probably null Het
Lman2l A T 1: 36,428,109 D269E possibly damaging Het
Mcc A G 18: 44,459,797 probably null Het
Nav2 T C 7: 49,598,817 F2302L possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1282 A G 2: 111,335,700 I126T probably damaging Het
Olfr1342 C A 4: 118,690,187 M88I probably benign Het
Sema6c T C 3: 95,167,083 F67L probably damaging Het
Sez6l A T 5: 112,464,731 V448D probably damaging Het
Spata2 A T 2: 167,483,360 V513E probably damaging Het
Susd3 T A 13: 49,238,859 M107L probably damaging Het
Tnni3k A G 3: 154,938,829 I564T probably benign Het
Zfp971 A G 2: 178,032,994 K129E possibly damaging Het
Other mutations in Smoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Smoc2 APN 17 14325614 missense probably damaging 1.00
IGL02085:Smoc2 APN 17 14347233 missense possibly damaging 0.79
IGL02309:Smoc2 APN 17 14375527 splice site probably benign
IGL02975:Smoc2 APN 17 14336610 missense probably damaging 0.98
enamel UTSW 17 14325634 missense probably damaging 1.00
FR4976:Smoc2 UTSW 17 14401562 small deletion probably benign
R2291:Smoc2 UTSW 17 14368971 missense possibly damaging 0.53
R2888:Smoc2 UTSW 17 14397625 critical splice donor site probably null
R3878:Smoc2 UTSW 17 14325617 missense probably damaging 1.00
R4872:Smoc2 UTSW 17 14369033 missense probably benign 0.12
R5153:Smoc2 UTSW 17 14336579 missense probably damaging 1.00
R5175:Smoc2 UTSW 17 14375457 missense possibly damaging 0.89
R5239:Smoc2 UTSW 17 14368965 missense probably benign 0.19
R5292:Smoc2 UTSW 17 14336573 missense probably damaging 0.98
R5794:Smoc2 UTSW 17 14369048 missense possibly damaging 0.94
R7810:Smoc2 UTSW 17 14325622 missense probably damaging 1.00
R7996:Smoc2 UTSW 17 14375468 nonsense probably null
R8811:Smoc2 UTSW 17 14325634 missense probably damaging 1.00
R9214:Smoc2 UTSW 17 14336577 missense probably damaging 1.00
R9287:Smoc2 UTSW 17 14399424 missense probably damaging 1.00
X0026:Smoc2 UTSW 17 14336633 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATTGTCAGTGCCACTACTTTGG -3'
(R):5'- CAGGACTGGACCCATGATTCTG -3'

Sequencing Primer
(F):5'- CAGTGCCACTACTTTGGTTACGG -3'
(R):5'- GACCCATGATTCTGGAAGGTC -3'
Posted On 2014-10-30