Mutagenetix > Incidental Mutation

Incidental Mutation 'R2343:Dsg2'

245910

Institutional Source

Beutler Lab

Gene Symbol

Dsg2

Ensembl Gene

ENSMUSG00000044393

Gene Name

desmoglein 2

Synonyms

D18Ertd293e

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R2343 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20558074-20604521 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20602298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1111 (V1111A)

Ref Sequence

ENSEMBL: ENSMUSP00000057096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059787]

AlphaFold

O55111

Predicted Effect

probably damaging
Transcript: ENSMUST00000059787
AA Change: V1111A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: V1111A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
CA	298	392	1.94e-8	SMART
CA	418	502	2.34e-16	SMART
transmembrane domain	618	640	N/A	INTRINSIC
low complexity region	822	838	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130296

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcr	T	C	10: 75,145,422	I691T	probably benign	Het
Col20a1	A	G	2: 181,001,331	T865A	possibly damaging	Het
Dmxl1	G	A	18: 49,890,678	R1676H	probably damaging	Het
Eif3g	T	C	9: 20,895,154	Y213C	probably damaging	Het
Fat4	C	T	3: 38,957,105	S2118F	probably damaging	Het
Gpr85	A	G	6: 13,836,696	S70P	probably damaging	Het
Krtap31-1	A	C	11: 99,908,021	T17P	possibly damaging	Het
Lig1	A	G	7: 13,292,195		probably null	Het
Lman2l	A	T	1: 36,428,109	D269E	possibly damaging	Het
Mcc	A	G	18: 44,459,797		probably null	Het
Nav2	T	C	7: 49,598,817	F2302L	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1282	A	G	2: 111,335,700	I126T	probably damaging	Het
Olfr1342	C	A	4: 118,690,187	M88I	probably benign	Het
Sema6c	T	C	3: 95,167,083	F67L	probably damaging	Het
Sez6l	A	T	5: 112,464,731	V448D	probably damaging	Het
Smoc2	A	G	17: 14,344,342	K160R	probably benign	Het
Spata2	A	T	2: 167,483,360	V513E	probably damaging	Het
Susd3	T	A	13: 49,238,859	M107L	probably damaging	Het
Tnni3k	A	G	3: 154,938,829	I564T	probably benign	Het
Zfp971	A	G	2: 178,032,994	K129E	possibly damaging	Het

Other mutations in Dsg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dsg2	APN	18	20601769	missense	probably benign	0.10
IGL00979:Dsg2	APN	18	20582767	missense	probably damaging	0.99
IGL01081:Dsg2	APN	18	20589942	unclassified	probably benign
IGL01358:Dsg2	APN	18	20601793	missense	probably damaging	0.98
IGL02002:Dsg2	APN	18	20579176	missense	probably damaging	1.00
IGL02263:Dsg2	APN	18	20590020	missense	possibly damaging	0.70
IGL02410:Dsg2	APN	18	20602132	missense	probably benign	0.04
IGL02553:Dsg2	APN	18	20592410	missense	probably damaging	1.00
IGL03036:Dsg2	APN	18	20579077	missense	probably damaging	0.99
dissolute	UTSW	18	20595951	splice site	probably null
Dysjunction	UTSW	18	20582939	nonsense	probably null
weg	UTSW	18	20580651	nonsense	probably null
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0112:Dsg2	UTSW	18	20583042	missense	probably benign	0.02
R0305:Dsg2	UTSW	18	20582695	splice site	probably benign
R0380:Dsg2	UTSW	18	20582939	nonsense	probably null
R0401:Dsg2	UTSW	18	20592508	splice site	probably benign
R0421:Dsg2	UTSW	18	20579391	missense	probably damaging	1.00
R0578:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R0667:Dsg2	UTSW	18	20573499	missense	possibly damaging	0.50
R1223:Dsg2	UTSW	18	20573493	missense	probably benign	0.23
R1433:Dsg2	UTSW	18	20582723	missense	probably damaging	0.98
R1543:Dsg2	UTSW	18	20594211	missense	probably benign	0.33
R1730:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1783:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1946:Dsg2	UTSW	18	20580548	missense	probably damaging	1.00
R1991:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R1992:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R2027:Dsg2	UTSW	18	20583004	unclassified	probably benign
R2109:Dsg2	UTSW	18	20592289	missense	probably benign	0.00
R2143:Dsg2	UTSW	18	20579161	missense	probably damaging	1.00
R2201:Dsg2	UTSW	18	20596054	missense	probably damaging	1.00
R2937:Dsg2	UTSW	18	20579128	missense	probably damaging	1.00
R3710:Dsg2	UTSW	18	20602117	missense	probably damaging	1.00
R3734:Dsg2	UTSW	18	20601947	missense	probably benign	0.41
R3773:Dsg2	UTSW	18	20591862	missense	probably damaging	1.00
R4176:Dsg2	UTSW	18	20580663	missense	probably benign	0.25
R4213:Dsg2	UTSW	18	20598514	missense	probably benign	0.01
R4299:Dsg2	UTSW	18	20595951	splice site	probably null
R4515:Dsg2	UTSW	18	20601387	missense	probably benign
R4649:Dsg2	UTSW	18	20602245	missense	possibly damaging	0.56
R4940:Dsg2	UTSW	18	20579430	missense	probably damaging	1.00
R4949:Dsg2	UTSW	18	20590184	missense	probably damaging	1.00
R4998:Dsg2	UTSW	18	20601521	missense	probably benign	0.26
R5078:Dsg2	UTSW	18	20596083	critical splice donor site	probably null
R5155:Dsg2	UTSW	18	20598658	missense	possibly damaging	0.67
R5398:Dsg2	UTSW	18	20579133	missense	probably benign	0.45
R5503:Dsg2	UTSW	18	20580651	nonsense	probably null
R6133:Dsg2	UTSW	18	20590089	missense	probably benign	0.00
R6163:Dsg2	UTSW	18	20598669	critical splice donor site	probably null
R6226:Dsg2	UTSW	18	20579449	missense	probably damaging	0.98
R6228:Dsg2	UTSW	18	20594293	critical splice donor site	probably null
R6241:Dsg2	UTSW	18	20590217	splice site	probably null
R6482:Dsg2	UTSW	18	20601314	missense	possibly damaging	0.69
R6524:Dsg2	UTSW	18	20583036	missense	probably damaging	1.00
R6856:Dsg2	UTSW	18	20601802	missense	probably damaging	0.98
R7058:Dsg2	UTSW	18	20592275	missense	probably benign	0.00
R7108:Dsg2	UTSW	18	20601863	missense	probably damaging	1.00
R7149:Dsg2	UTSW	18	20579454	missense	probably damaging	0.98
R7207:Dsg2	UTSW	18	20601459	missense	probably damaging	0.99
R7256:Dsg2	UTSW	18	20591931	missense	possibly damaging	0.96
R7315:Dsg2	UTSW	18	20579160	missense	probably damaging	0.97
R7471:Dsg2	UTSW	18	20580618	missense	probably benign	0.08
R7558:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R8094:Dsg2	UTSW	18	20583004	unclassified	probably benign
R8118:Dsg2	UTSW	18	20582801	missense	probably benign	0.11
R8157:Dsg2	UTSW	18	20580549	missense	probably damaging	1.00
R8307:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8308:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8488:Dsg2	UTSW	18	20601374	missense	probably damaging	1.00
R8520:Dsg2	UTSW	18	20579451	missense	probably damaging	1.00
R8669:Dsg2	UTSW	18	20590075	missense	probably damaging	1.00
R8675:Dsg2	UTSW	18	20601918	missense	possibly damaging	0.75
R8750:Dsg2	UTSW	18	20575012	missense	possibly damaging	0.90
R8773:Dsg2	UTSW	18	20582999	missense	probably damaging	1.00
R8888:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8895:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8912:Dsg2	UTSW	18	20582821	missense	probably damaging	1.00
R8925:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R8927:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R9263:Dsg2	UTSW	18	20594166	missense	probably benign	0.33
R9328:Dsg2	UTSW	18	20582790	missense	possibly damaging	0.81
Z1176:Dsg2	UTSW	18	20580621	missense	probably damaging	1.00
Z1177:Dsg2	UTSW	18	20602249	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAATACTAACTCCTGCTTCCACTC -3'
(R):5'- GGCACTGAGGAACTAGCATC -3'

Sequencing Primer
(F):5'- TCTGCAGTCCAGCTACCAG -3'
(R):5'- ACCCTACCTGAGACATGGTG -3'

Posted On

2014-10-30