Incidental Mutation 'R2343:Mcc'
ID245911
Institutional Source Beutler Lab
Gene Symbol Mcc
Ensembl Gene ENSMUSG00000071856
Gene Namemutated in colorectal cancers
SynonymsD18Ertd451e
Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2343 (G1)
Quality Score95
Status Not validated
Chromosome18
Chromosomal Location44425060-44812182 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 44459797 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089874] [ENSMUST00000164666]
Predicted Effect probably null
Transcript: ENSMUST00000089874
SMART Domains Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
EFh 24 52 1.36e-3 SMART
EFh 57 85 7.36e0 SMART
coiled coil region 196 308 N/A INTRINSIC
coiled coil region 395 466 N/A INTRINSIC
low complexity region 488 493 N/A INTRINSIC
low complexity region 512 517 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 577 641 2.6e-32 PFAM
low complexity region 715 731 N/A INTRINSIC
coiled coil region 738 834 N/A INTRINSIC
low complexity region 853 863 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 906 972 1.1e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164666
SMART Domains Protein: ENSMUSP00000128032
Gene: ENSMUSG00000071856

DomainStartEndE-ValueType
coiled coil region 21 133 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 233 289 1.2e-14 PFAM
low complexity region 313 318 N/A INTRINSIC
low complexity region 337 342 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 401 467 3.8e-32 PFAM
low complexity region 540 556 N/A INTRINSIC
coiled coil region 563 659 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 730 798 1.3e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 75,145,422 I691T probably benign Het
Col20a1 A G 2: 181,001,331 T865A possibly damaging Het
Dmxl1 G A 18: 49,890,678 R1676H probably damaging Het
Dsg2 T C 18: 20,602,298 V1111A probably damaging Het
Eif3g T C 9: 20,895,154 Y213C probably damaging Het
Fat4 C T 3: 38,957,105 S2118F probably damaging Het
Gpr85 A G 6: 13,836,696 S70P probably damaging Het
Krtap31-1 A C 11: 99,908,021 T17P possibly damaging Het
Lig1 A G 7: 13,292,195 probably null Het
Lman2l A T 1: 36,428,109 D269E possibly damaging Het
Nav2 T C 7: 49,598,817 F2302L possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1282 A G 2: 111,335,700 I126T probably damaging Het
Olfr1342 C A 4: 118,690,187 M88I probably benign Het
Sema6c T C 3: 95,167,083 F67L probably damaging Het
Sez6l A T 5: 112,464,731 V448D probably damaging Het
Smoc2 A G 17: 14,344,342 K160R probably benign Het
Spata2 A T 2: 167,483,360 V513E probably damaging Het
Susd3 T A 13: 49,238,859 M107L probably damaging Het
Tnni3k A G 3: 154,938,829 I564T probably benign Het
Zfp971 A G 2: 178,032,994 K129E possibly damaging Het
Other mutations in Mcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Mcc APN 18 44449216 missense possibly damaging 0.93
IGL00981:Mcc APN 18 44449349 missense probably damaging 0.99
IGL00985:Mcc APN 18 44491239 missense probably damaging 1.00
IGL01674:Mcc APN 18 44491156 missense probably benign 0.10
IGL01862:Mcc APN 18 44759296 missense probably benign 0.00
IGL01935:Mcc APN 18 44519516 critical splice donor site probably null
IGL02168:Mcc APN 18 44449299 missense probably damaging 0.97
IGL02449:Mcc APN 18 44459958 missense probably benign 0.10
IGL02613:Mcc APN 18 44429954 missense probably damaging 1.00
IGL02709:Mcc APN 18 44445810 missense possibly damaging 0.73
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0021:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0022:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0063:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0064:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0217:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0218:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0243:Mcc UTSW 18 44759299 missense probably benign
R0373:Mcc UTSW 18 44475222 missense probably benign 0.01
R0564:Mcc UTSW 18 44468507 missense probably damaging 1.00
R0604:Mcc UTSW 18 44473756 missense probably damaging 1.00
R0691:Mcc UTSW 18 44445860 missense possibly damaging 0.67
R0965:Mcc UTSW 18 44724526 missense probably benign 0.41
R1015:Mcc UTSW 18 44724669 missense probably benign
R1186:Mcc UTSW 18 44759403 missense probably benign
R1215:Mcc UTSW 18 44468494 missense possibly damaging 0.93
R1878:Mcc UTSW 18 44468400 missense possibly damaging 0.69
R1990:Mcc UTSW 18 44491315 nonsense probably null
R1991:Mcc UTSW 18 44491315 nonsense probably null
R1992:Mcc UTSW 18 44491315 nonsense probably null
R2186:Mcc UTSW 18 44812078 missense possibly damaging 0.71
R2189:Mcc UTSW 18 44534230 missense possibly damaging 0.93
R2258:Mcc UTSW 18 44475136 missense probably damaging 1.00
R2267:Mcc UTSW 18 44519541 missense probably damaging 0.99
R2310:Mcc UTSW 18 44431366 missense probably damaging 1.00
R2377:Mcc UTSW 18 44519549 missense probably damaging 1.00
R3110:Mcc UTSW 18 44449263 missense probably damaging 1.00
R3112:Mcc UTSW 18 44449263 missense probably damaging 1.00
R4135:Mcc UTSW 18 44724640 missense probably benign 0.03
R4404:Mcc UTSW 18 44759298 missense probably benign
R4600:Mcc UTSW 18 44519520 missense probably damaging 1.00
R4606:Mcc UTSW 18 44468421 missense probably damaging 0.96
R4721:Mcc UTSW 18 44519556 missense probably damaging 1.00
R5858:Mcc UTSW 18 44510141 missense probably damaging 0.98
R5997:Mcc UTSW 18 44449321 missense probably damaging 1.00
R6482:Mcc UTSW 18 44445864 missense possibly damaging 0.94
R6502:Mcc UTSW 18 44468390 nonsense probably null
R6502:Mcc UTSW 18 44468391 missense probably damaging 1.00
R6518:Mcc UTSW 18 44661811 start gained probably benign
R6796:Mcc UTSW 18 44724560 missense probably benign
R6846:Mcc UTSW 18 44473640 missense possibly damaging 0.63
R6879:Mcc UTSW 18 44812112 missense unknown
R7147:Mcc UTSW 18 44493513 missense probably damaging 0.99
R7475:Mcc UTSW 18 44476236 missense probably damaging 0.98
R7515:Mcc UTSW 18 44493432 missense probably benign 0.02
R7608:Mcc UTSW 18 44491227 missense possibly damaging 0.83
X0010:Mcc UTSW 18 44429957 missense possibly damaging 0.94
Z1177:Mcc UTSW 18 44491246 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTTCCACAGAAGCACAAGAAGG -3'
(R):5'- TCTGCCTGCACCAAGTAACC -3'

Sequencing Primer
(F):5'- AGAAGGCCACTTTCTAGTCCC -3'
(R):5'- TGCCTGCACCAAGTAACCTATTG -3'
Posted On2014-10-30