Mutagenetix > Incidental Mutation

Incidental Mutation 'R2343:Mcc'

245911

Institutional Source

Beutler Lab

Gene Symbol

Mcc

Ensembl Gene

ENSMUSG00000071856

Gene Name

mutated in colorectal cancers

Synonyms

D18Ertd451e

Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2343 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

44425060-44812182 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 44459797 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089874] [ENSMUST00000164666]

AlphaFold

E9PWI3

Predicted Effect

probably null
Transcript: ENSMUST00000089874

SMART Domains

Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
EFh	24	52	1.36e-3	SMART
EFh	57	85	7.36e0	SMART
coiled coil region	196	308	N/A	INTRINSIC
coiled coil region	395	466	N/A	INTRINSIC
low complexity region	488	493	N/A	INTRINSIC
low complexity region	512	517	N/A	INTRINSIC
low complexity region	523	537	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	577	641	2.6e-32	PFAM
low complexity region	715	731	N/A	INTRINSIC
coiled coil region	738	834	N/A	INTRINSIC
low complexity region	853	863	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	906	972	1.1e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000164666

SMART Domains

Protein: ENSMUSP00000128032
Gene: ENSMUSG00000071856

Domain	Start	End	E-Value	Type
coiled coil region	21	133	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	233	289	1.2e-14	PFAM
low complexity region	313	318	N/A	INTRINSIC
low complexity region	337	342	N/A	INTRINSIC
low complexity region	348	362	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	401	467	3.8e-32	PFAM
low complexity region	540	556	N/A	INTRINSIC
coiled coil region	563	659	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	730	798	1.3e-27	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcr	T	C	10: 75,145,422	I691T	probably benign	Het
Col20a1	A	G	2: 181,001,331	T865A	possibly damaging	Het
Dmxl1	G	A	18: 49,890,678	R1676H	probably damaging	Het
Dsg2	T	C	18: 20,602,298	V1111A	probably damaging	Het
Eif3g	T	C	9: 20,895,154	Y213C	probably damaging	Het
Fat4	C	T	3: 38,957,105	S2118F	probably damaging	Het
Gpr85	A	G	6: 13,836,696	S70P	probably damaging	Het
Krtap31-1	A	C	11: 99,908,021	T17P	possibly damaging	Het
Lig1	A	G	7: 13,292,195		probably null	Het
Lman2l	A	T	1: 36,428,109	D269E	possibly damaging	Het
Nav2	T	C	7: 49,598,817	F2302L	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1282	A	G	2: 111,335,700	I126T	probably damaging	Het
Olfr1342	C	A	4: 118,690,187	M88I	probably benign	Het
Sema6c	T	C	3: 95,167,083	F67L	probably damaging	Het
Sez6l	A	T	5: 112,464,731	V448D	probably damaging	Het
Smoc2	A	G	17: 14,344,342	K160R	probably benign	Het
Spata2	A	T	2: 167,483,360	V513E	probably damaging	Het
Susd3	T	A	13: 49,238,859	M107L	probably damaging	Het
Tnni3k	A	G	3: 154,938,829	I564T	probably benign	Het
Zfp971	A	G	2: 178,032,994	K129E	possibly damaging	Het

Other mutations in Mcc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Mcc	APN	18	44449216	missense	possibly damaging	0.93
IGL00981:Mcc	APN	18	44449349	missense	probably damaging	0.99
IGL00985:Mcc	APN	18	44491239	missense	probably damaging	1.00
IGL01674:Mcc	APN	18	44491156	missense	probably benign	0.10
IGL01862:Mcc	APN	18	44759296	missense	probably benign	0.00
IGL01935:Mcc	APN	18	44519516	critical splice donor site	probably null
IGL02168:Mcc	APN	18	44449299	missense	probably damaging	0.97
IGL02449:Mcc	APN	18	44459958	missense	probably benign	0.10
IGL02613:Mcc	APN	18	44429954	missense	probably damaging	1.00
IGL02709:Mcc	APN	18	44445810	missense	possibly damaging	0.73
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0021:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0022:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0063:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0064:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0217:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0218:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0243:Mcc	UTSW	18	44759299	missense	probably benign
R0373:Mcc	UTSW	18	44475222	missense	probably benign	0.01
R0564:Mcc	UTSW	18	44468507	missense	probably damaging	1.00
R0604:Mcc	UTSW	18	44473756	missense	probably damaging	1.00
R0691:Mcc	UTSW	18	44445860	missense	possibly damaging	0.67
R0965:Mcc	UTSW	18	44724526	missense	probably benign	0.41
R1015:Mcc	UTSW	18	44724669	missense	probably benign
R1186:Mcc	UTSW	18	44759403	missense	probably benign
R1215:Mcc	UTSW	18	44468494	missense	possibly damaging	0.93
R1878:Mcc	UTSW	18	44468400	missense	possibly damaging	0.69
R1990:Mcc	UTSW	18	44491315	nonsense	probably null
R1991:Mcc	UTSW	18	44491315	nonsense	probably null
R1992:Mcc	UTSW	18	44491315	nonsense	probably null
R2186:Mcc	UTSW	18	44812078	missense	possibly damaging	0.71
R2189:Mcc	UTSW	18	44534230	missense	possibly damaging	0.93
R2258:Mcc	UTSW	18	44475136	missense	probably damaging	1.00
R2267:Mcc	UTSW	18	44519541	missense	probably damaging	0.99
R2310:Mcc	UTSW	18	44431366	missense	probably damaging	1.00
R2377:Mcc	UTSW	18	44519549	missense	probably damaging	1.00
R3110:Mcc	UTSW	18	44449263	missense	probably damaging	1.00
R3112:Mcc	UTSW	18	44449263	missense	probably damaging	1.00
R4135:Mcc	UTSW	18	44724640	missense	probably benign	0.03
R4404:Mcc	UTSW	18	44759298	missense	probably benign
R4600:Mcc	UTSW	18	44519520	missense	probably damaging	1.00
R4606:Mcc	UTSW	18	44468421	missense	probably damaging	0.96
R4721:Mcc	UTSW	18	44519556	missense	probably damaging	1.00
R5858:Mcc	UTSW	18	44510141	missense	probably damaging	0.98
R5997:Mcc	UTSW	18	44449321	missense	probably damaging	1.00
R6482:Mcc	UTSW	18	44445864	missense	possibly damaging	0.94
R6502:Mcc	UTSW	18	44468390	nonsense	probably null
R6502:Mcc	UTSW	18	44468391	missense	probably damaging	1.00
R6518:Mcc	UTSW	18	44661811	start gained	probably benign
R6796:Mcc	UTSW	18	44724560	missense	probably benign
R6846:Mcc	UTSW	18	44473640	missense	possibly damaging	0.63
R6879:Mcc	UTSW	18	44812112	missense	unknown
R7147:Mcc	UTSW	18	44493513	missense	probably damaging	0.99
R7475:Mcc	UTSW	18	44476236	missense	probably damaging	0.98
R7515:Mcc	UTSW	18	44493432	missense	probably benign	0.02
R7608:Mcc	UTSW	18	44491227	missense	possibly damaging	0.83
R8092:Mcc	UTSW	18	44759232	missense	probably benign	0.00
R8119:Mcc	UTSW	18	44468433	missense	possibly damaging	0.95
R8162:Mcc	UTSW	18	44449441	critical splice acceptor site	probably null
R8187:Mcc	UTSW	18	44534260	missense	possibly damaging	0.53
R8716:Mcc	UTSW	18	44449336	missense	possibly damaging	0.92
R8744:Mcc	UTSW	18	44724572	missense	probably benign
R9383:Mcc	UTSW	18	44442918	missense	probably benign	0.24
R9517:Mcc	UTSW	18	44661727	missense	probably damaging	1.00
R9570:Mcc	UTSW	18	44445858	missense	probably damaging	0.97
R9590:Mcc	UTSW	18	44459910	missense	possibly damaging	0.93
X0010:Mcc	UTSW	18	44429957	missense	possibly damaging	0.94
Z1177:Mcc	UTSW	18	44491246	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TTTCCACAGAAGCACAAGAAGG -3'
(R):5'- TCTGCCTGCACCAAGTAACC -3'

Sequencing Primer
(F):5'- AGAAGGCCACTTTCTAGTCCC -3'
(R):5'- TGCCTGCACCAAGTAACCTATTG -3'

Posted On

2014-10-30