Incidental Mutation 'R2344:Olfr813'
ID245928
Institutional Source Beutler Lab
Gene Symbol Olfr813
Ensembl Gene ENSMUSG00000052818
Gene Nameolfactory receptor 813
SynonymsMOR108-3, GA_x6K02T2PULF-11535078-11536010
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R2344 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129855367-129858722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129856541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 8 (T8S)
Ref Sequence ENSEMBL: ENSMUSP00000145260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064893] [ENSMUST00000204622]
Predicted Effect probably benign
Transcript: ENSMUST00000064893
AA Change: T8S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000063431
Gene: ENSMUSG00000052818
AA Change: T8S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.2e-49 PFAM
Pfam:7tm_1 39 288 3.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204622
AA Change: T8S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000145260
Gene: ENSMUSG00000052818
AA Change: T8S

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 3.5e-49 PFAM
Pfam:7tm_1 54 303 1.3e-21 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b A G 13: 14,153,490 Q247R probably benign Het
Bend7 A T 2: 4,788,534 D383V probably damaging Het
Calm4 A G 13: 3,838,298 K135E possibly damaging Het
Cdh23 T C 10: 60,316,724 D2412G probably damaging Het
Col6a5 T C 9: 105,928,537 T1057A unknown Het
Dpf3 T G 12: 83,350,820 D90A probably damaging Het
Dtl A T 1: 191,548,378 M348K probably benign Het
Elmo3 T C 8: 105,309,161 Y558H probably damaging Het
Epha3 C T 16: 63,652,383 V79I possibly damaging Het
Ercc5 T C 1: 44,167,169 M414T probably benign Het
Fam217a T C 13: 34,910,335 I389M probably damaging Het
Fsip2 T C 2: 82,989,913 F5330S possibly damaging Het
Grin2a T C 16: 9,663,235 I533V probably benign Het
Gsdma2 T C 11: 98,655,591 L167P probably damaging Het
Gys2 A T 6: 142,446,022 F505I probably damaging Het
Il6 A T 5: 30,014,856 M77L probably benign Het
Pgm2l1 A G 7: 100,259,908 I194V probably damaging Het
Rbpjl G T 2: 164,414,392 V433L probably damaging Het
Rps10 C G 17: 27,634,107 R96P possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Supt16 T C 14: 52,178,118 T387A probably benign Het
Usf3 C T 16: 44,216,051 T298M probably benign Het
Usp49 T C 17: 47,672,903 F278L probably damaging Het
Zfp729b A G 13: 67,592,233 C648R probably damaging Het
Other mutations in Olfr813
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Olfr813 APN 10 129856628 missense probably benign 0.00
IGL01650:Olfr813 APN 10 129857067 missense probably damaging 1.00
IGL01734:Olfr813 APN 10 129856802 missense probably benign 0.36
IGL01909:Olfr813 APN 10 129857081 missense probably damaging 0.99
R0256:Olfr813 UTSW 10 129857037 missense probably damaging 1.00
R0607:Olfr813 UTSW 10 129857201 missense possibly damaging 0.67
R0924:Olfr813 UTSW 10 129856646 missense probably damaging 1.00
R1345:Olfr813 UTSW 10 129856890 missense probably damaging 1.00
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R3851:Olfr813 UTSW 10 129857147 missense probably benign 0.00
R4486:Olfr813 UTSW 10 129856698 missense probably damaging 1.00
R4934:Olfr813 UTSW 10 129857027 missense possibly damaging 0.91
R5397:Olfr813 UTSW 10 129856710 missense probably damaging 1.00
R5644:Olfr813 UTSW 10 129857427 missense probably benign 0.38
R5925:Olfr813 UTSW 10 129856875 missense probably damaging 1.00
R6224:Olfr813 UTSW 10 129857192 missense probably benign 0.17
R7839:Olfr813 UTSW 10 129857030 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGGTCTCTAATAATGCAAGGAGAC -3'
(R):5'- TGTCCTTAGTTAAGATGCTGACC -3'

Sequencing Primer
(F):5'- ATGACACAGGAAAAGTATAATGTCC -3'
(R):5'- GATGCTGACCAAAAACCTAGGGTTAC -3'
Posted On2014-10-30