Incidental Mutation 'R2344:Fam217a'
ID245933
Institutional Source Beutler Lab
Gene Symbol Fam217a
Ensembl Gene ENSMUSG00000021414
Gene Namefamily with sequence similarity 217, member A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R2344 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location34909960-34924310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34910335 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 389 (I389M)
Ref Sequence ENSEMBL: ENSMUSP00000153128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021851] [ENSMUST00000077853] [ENSMUST00000223834] [ENSMUST00000225242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021851
AA Change: I480M

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021851
Gene: ENSMUSG00000021414
AA Change: I480M

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:FAM217 206 411 2e-54 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077853
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223228
Predicted Effect probably damaging
Transcript: ENSMUST00000223834
AA Change: I632M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224613
Predicted Effect probably damaging
Transcript: ENSMUST00000225242
AA Change: I389M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b A G 13: 14,153,490 Q247R probably benign Het
Bend7 A T 2: 4,788,534 D383V probably damaging Het
Calm4 A G 13: 3,838,298 K135E possibly damaging Het
Cdh23 T C 10: 60,316,724 D2412G probably damaging Het
Col6a5 T C 9: 105,928,537 T1057A unknown Het
Dpf3 T G 12: 83,350,820 D90A probably damaging Het
Dtl A T 1: 191,548,378 M348K probably benign Het
Elmo3 T C 8: 105,309,161 Y558H probably damaging Het
Epha3 C T 16: 63,652,383 V79I possibly damaging Het
Ercc5 T C 1: 44,167,169 M414T probably benign Het
Fsip2 T C 2: 82,989,913 F5330S possibly damaging Het
Grin2a T C 16: 9,663,235 I533V probably benign Het
Gsdma2 T C 11: 98,655,591 L167P probably damaging Het
Gys2 A T 6: 142,446,022 F505I probably damaging Het
Il6 A T 5: 30,014,856 M77L probably benign Het
Olfr813 A T 10: 129,856,541 T8S probably benign Het
Pgm2l1 A G 7: 100,259,908 I194V probably damaging Het
Rbpjl G T 2: 164,414,392 V433L probably damaging Het
Rps10 C G 17: 27,634,107 R96P possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Supt16 T C 14: 52,178,118 T387A probably benign Het
Usf3 C T 16: 44,216,051 T298M probably benign Het
Usp49 T C 17: 47,672,903 F278L probably damaging Het
Zfp729b A G 13: 67,592,233 C648R probably damaging Het
Other mutations in Fam217a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Fam217a APN 13 34915649 splice site probably benign
IGL02222:Fam217a APN 13 34911119 missense probably damaging 1.00
IGL02302:Fam217a APN 13 34911161 missense probably damaging 1.00
IGL02371:Fam217a APN 13 34911401 missense possibly damaging 0.53
IGL02538:Fam217a APN 13 34911113 missense probably damaging 0.98
R0324:Fam217a UTSW 13 34910961 missense possibly damaging 0.71
R0616:Fam217a UTSW 13 34913683 missense probably benign 0.03
R1497:Fam217a UTSW 13 34911212 missense probably damaging 0.97
R1934:Fam217a UTSW 13 34910881 missense probably damaging 1.00
R1981:Fam217a UTSW 13 34916754 missense probably benign 0.07
R2133:Fam217a UTSW 13 34913680 missense probably damaging 1.00
R4182:Fam217a UTSW 13 34910256 missense possibly damaging 0.75
R4601:Fam217a UTSW 13 34911302 missense probably damaging 1.00
R4909:Fam217a UTSW 13 34910406 missense probably damaging 1.00
R5583:Fam217a UTSW 13 34910297 missense probably damaging 1.00
R6027:Fam217a UTSW 13 34910994 missense possibly damaging 0.77
R6496:Fam217a UTSW 13 34910802 nonsense probably null
R7166:Fam217a UTSW 13 34910315 missense probably benign 0.07
R7394:Fam217a UTSW 13 34910279 missense possibly damaging 0.73
R7710:Fam217a UTSW 13 34911128 missense possibly damaging 0.92
R8409:Fam217a UTSW 13 34916898 missense probably benign
R8716:Fam217a UTSW 13 34924265 start gained probably benign
R8782:Fam217a UTSW 13 34911050 missense probably benign
R8936:Fam217a UTSW 13 34911164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTGTCTCAATGATGAACC -3'
(R):5'- GTGGCTCATGATGACCTAAAGAAC -3'

Sequencing Primer
(F):5'- CAATGATGAACCATATTTTAGCTGGG -3'
(R):5'- CCAGTTTAAACCCTTGCCAGG -3'
Posted On2014-10-30