Incidental Mutation 'R2346:Vmn1r20'
ID245947
Institutional Source Beutler Lab
Gene Symbol Vmn1r20
Ensembl Gene ENSMUSG00000115253
Gene Namevomeronasal 1 receptor 20
SynonymsGm5569
MMRRC Submission 040329-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R2346 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location57428930-57435261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57431946 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 86 (M86V)
Ref Sequence ENSEMBL: ENSMUSP00000153815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176085] [ENSMUST00000226808] [ENSMUST00000227909]
Predicted Effect possibly damaging
Transcript: ENSMUST00000176085
AA Change: M86V

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134973
Gene: ENSMUSG00000093679
AA Change: M86V

DomainStartEndE-ValueType
Pfam:V1R 28 293 2.3e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226808
AA Change: M86V

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227909
AA Change: M86V

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (21/21)
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC051665 T C 13: 60,783,960 probably benign Het
Ces1a C T 8: 93,025,319 V396M probably benign Het
Dnm2 T C 9: 21,467,556 L137P probably damaging Het
Elf2 A G 3: 51,257,444 S380P probably benign Het
Fbxw15 T C 9: 109,565,432 Y105C probably damaging Het
Gm12588 T C 11: 121,906,168 Y285C probably benign Het
Gm21276 T A 7: 38,768,151 noncoding transcript Het
Kat2b A G 17: 53,610,904 N97S probably benign Het
Mus81 A G 19: 5,484,963 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr160 T C 9: 37,711,365 R305G possibly damaging Het
Pkhd1l1 C A 15: 44,560,506 A3148E possibly damaging Het
Prkar2b T C 12: 31,972,150 N212S probably benign Het
Rp1 T A 1: 4,348,013 T959S probably damaging Het
Samd4 G A 14: 46,884,842 G8R probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l-ps1 A G 17: 34,770,102 noncoding transcript Het
Vwa1 A G 4: 155,773,069 Y91H probably benign Het
Zan A G 5: 137,421,867 S2843P unknown Het
Zbtb39 A T 10: 127,741,581 Q8L possibly damaging Het
Other mutations in Vmn1r20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Vmn1r20 APN 6 57431740 missense probably damaging 1.00
IGL02622:Vmn1r20 APN 6 57432598 missense probably damaging 0.99
IGL02636:Vmn1r20 APN 6 57431761 missense probably benign
R0006:Vmn1r20 UTSW 6 57432305 missense probably damaging 0.99
R0079:Vmn1r20 UTSW 6 57431792 missense possibly damaging 0.70
R0200:Vmn1r20 UTSW 6 57432099 missense probably damaging 0.96
R1675:Vmn1r20 UTSW 6 57431952 missense probably benign 0.00
R1734:Vmn1r20 UTSW 6 57432300 missense probably damaging 1.00
R1883:Vmn1r20 UTSW 6 57432321 missense probably benign 0.14
R2049:Vmn1r20 UTSW 6 57431958 missense probably damaging 1.00
R2307:Vmn1r20 UTSW 6 57432136 missense probably benign 0.03
R4405:Vmn1r20 UTSW 6 57432057 missense probably benign 0.02
R4946:Vmn1r20 UTSW 6 57432174 missense probably damaging 0.98
R5259:Vmn1r20 UTSW 6 57432065 nonsense probably null
R5321:Vmn1r20 UTSW 6 57432442 missense probably benign 0.21
R5911:Vmn1r20 UTSW 6 57431789 missense probably benign 0.16
R6042:Vmn1r20 UTSW 6 57432406 missense possibly damaging 0.90
R6298:Vmn1r20 UTSW 6 57432127 missense probably benign
R6314:Vmn1r20 UTSW 6 57432057 missense probably benign 0.00
R6331:Vmn1r20 UTSW 6 57431670 unclassified probably null
R6482:Vmn1r20 UTSW 6 57432108 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGAATGTCCTTTATTTCCAAGCTGG -3'
(R):5'- AGATCCGGCTACTACTGTAGG -3'

Sequencing Primer
(F):5'- GACTTGGAGTCCTAGCAAATATGTC -3'
(R):5'- TCCGGCTACTACTGTAGGAAAAGC -3'
Posted On2014-10-30