Incidental Mutation 'R2346:Dnm2'
ID245951
Institutional Source Beutler Lab
Gene Symbol Dnm2
Ensembl Gene ENSMUSG00000033335
Gene Namedynamin 2
Synonymsb2b2159Clo, Dyn2
MMRRC Submission 040329-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2346 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21424908-21507759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21467556 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 137 (L137P)
Ref Sequence ENSEMBL: ENSMUSP00000134243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072362] [ENSMUST00000091087] [ENSMUST00000115404] [ENSMUST00000165766] [ENSMUST00000172482] [ENSMUST00000173397] [ENSMUST00000174828]
Predicted Effect probably damaging
Transcript: ENSMUST00000072362
AA Change: L137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072199
Gene: ENSMUSG00000033335
AA Change: L137P

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091087
AA Change: L137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088616
Gene: ENSMUSG00000033335
AA Change: L137P

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 516 623 8e-13 SMART
GED 644 735 2.57e-28 SMART
low complexity region 736 748 N/A INTRINSIC
low complexity region 773 795 N/A INTRINSIC
low complexity region 827 860 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115404
AA Change: L137P

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335
AA Change: L137P

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165766
AA Change: L137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128961
Gene: ENSMUSG00000033335
AA Change: L137P

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 858 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169194
Predicted Effect probably damaging
Transcript: ENSMUST00000172482
AA Change: L137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335
AA Change: L137P

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173397
AA Change: L137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134243
Gene: ENSMUSG00000033335
AA Change: L137P

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 863 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174050
AA Change: L87P
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335
AA Change: L87P

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174828
SMART Domains Protein: ENSMUSP00000133961
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
Pfam:Dynamin_N 34 57 9.1e-8 PFAM
Meta Mutation Damage Score 0.9698 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (21/21)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele die prior to E8-E12. Mice heterozygous for a knock-out allele exhibit muscle atrophy and weakness, intermyofibrillar disorganization, and centrally localized mitochondria and sarcoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC051665 T C 13: 60,783,960 probably benign Het
Ces1a C T 8: 93,025,319 V396M probably benign Het
Elf2 A G 3: 51,257,444 S380P probably benign Het
Fbxw15 T C 9: 109,565,432 Y105C probably damaging Het
Gm12588 T C 11: 121,906,168 Y285C probably benign Het
Gm21276 T A 7: 38,768,151 noncoding transcript Het
Kat2b A G 17: 53,610,904 N97S probably benign Het
Mus81 A G 19: 5,484,963 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr160 T C 9: 37,711,365 R305G possibly damaging Het
Pkhd1l1 C A 15: 44,560,506 A3148E possibly damaging Het
Prkar2b T C 12: 31,972,150 N212S probably benign Het
Rp1 T A 1: 4,348,013 T959S probably damaging Het
Samd4 G A 14: 46,884,842 G8R probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l-ps1 A G 17: 34,770,102 noncoding transcript Het
Vmn1r20 A G 6: 57,431,946 M86V possibly damaging Het
Vwa1 A G 4: 155,773,069 Y91H probably benign Het
Zan A G 5: 137,421,867 S2843P unknown Het
Zbtb39 A T 10: 127,741,581 Q8L possibly damaging Het
Other mutations in Dnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Dnm2 APN 9 21481376 missense probably damaging 1.00
IGL01757:Dnm2 APN 9 21465619 missense probably damaging 1.00
IGL02142:Dnm2 APN 9 21500353 missense probably damaging 1.00
IGL02195:Dnm2 APN 9 21425249 missense probably damaging 1.00
IGL02472:Dnm2 APN 9 21485708 missense possibly damaging 0.55
IGL03161:Dnm2 APN 9 21485724 splice site probably benign
IGL03392:Dnm2 APN 9 21474611 missense probably damaging 1.00
R0302:Dnm2 UTSW 9 21500343 missense probably benign 0.27
R0743:Dnm2 UTSW 9 21500265 missense probably damaging 1.00
R0945:Dnm2 UTSW 9 21505660 missense probably damaging 0.97
R1629:Dnm2 UTSW 9 21504458 missense probably damaging 1.00
R1678:Dnm2 UTSW 9 21467532 missense possibly damaging 0.89
R1848:Dnm2 UTSW 9 21505681 missense possibly damaging 0.87
R2084:Dnm2 UTSW 9 21500371 critical splice donor site probably null
R2214:Dnm2 UTSW 9 21485723 critical splice donor site probably null
R3711:Dnm2 UTSW 9 21506373 unclassified probably benign
R3796:Dnm2 UTSW 9 21505487 missense probably benign
R4017:Dnm2 UTSW 9 21494604 missense probably damaging 1.00
R4432:Dnm2 UTSW 9 21491304 intron probably benign
R4583:Dnm2 UTSW 9 21504446 missense probably damaging 1.00
R4604:Dnm2 UTSW 9 21504664 critical splice donor site probably null
R4735:Dnm2 UTSW 9 21474587 missense probably damaging 0.99
R4803:Dnm2 UTSW 9 21474629 missense probably damaging 1.00
R4832:Dnm2 UTSW 9 21474679 splice site probably null
R4836:Dnm2 UTSW 9 21491330 intron probably benign
R4937:Dnm2 UTSW 9 21481337 missense probably benign 0.00
R4948:Dnm2 UTSW 9 21504533 missense possibly damaging 0.90
R5059:Dnm2 UTSW 9 21504578 missense probably damaging 1.00
R5291:Dnm2 UTSW 9 21478907 missense probably damaging 1.00
R5538:Dnm2 UTSW 9 21505627 missense probably benign 0.05
R5613:Dnm2 UTSW 9 21472667 missense probably damaging 1.00
R5805:Dnm2 UTSW 9 21467669 missense probably damaging 0.97
R6253:Dnm2 UTSW 9 21500275 missense probably damaging 1.00
R6586:Dnm2 UTSW 9 21505646 missense probably benign 0.32
R6826:Dnm2 UTSW 9 21504471 nonsense probably null
R6855:Dnm2 UTSW 9 21476585 missense probably damaging 1.00
R7121:Dnm2 UTSW 9 21474566 missense probably benign 0.31
R7307:Dnm2 UTSW 9 21485687 missense probably damaging 1.00
R7318:Dnm2 UTSW 9 21505567 missense possibly damaging 0.46
R7467:Dnm2 UTSW 9 21481376 missense probably damaging 1.00
R7619:Dnm2 UTSW 9 21505634 missense probably benign 0.00
R7673:Dnm2 UTSW 9 21481421 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTGAAATGTGTTCTAGTAGGAG -3'
(R):5'- TGTGACAGAAAGCACCTCAG -3'

Sequencing Primer
(F):5'- TAGGAGTGTTAGGAGTGACCCC -3'
(R):5'- AGCACTACTGGCTGCTGC -3'
Posted On2014-10-30