Incidental Mutation 'R2346:Olfr160'
ID245952
Institutional Source Beutler Lab
Gene Symbol Olfr160
Ensembl Gene ENSMUSG00000061165
Gene Nameolfactory receptor 160
SynonymsGA_x6K02T2PVTD-31389446-31388517, MOR171-3, M72, MOR171-3
MMRRC Submission 040329-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2346 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37708964-37716250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37711365 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 305 (R305G)
Ref Sequence ENSEMBL: ENSMUSP00000151178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104875] [ENSMUST00000211952] [ENSMUST00000215727]
Predicted Effect possibly damaging
Transcript: ENSMUST00000104875
AA Change: R305G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100468
Gene: ENSMUSG00000061165
AA Change: R305G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.5e-48 PFAM
Pfam:7tm_1 41 290 6.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211952
AA Change: R305G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215727
AA Change: R305G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1145 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (21/21)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele respond heterogeneously to odorants and display abnormal innervation of glomeruli by olfactory sensory axons in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC051665 T C 13: 60,783,960 probably benign Het
Ces1a C T 8: 93,025,319 V396M probably benign Het
Dnm2 T C 9: 21,467,556 L137P probably damaging Het
Elf2 A G 3: 51,257,444 S380P probably benign Het
Fbxw15 T C 9: 109,565,432 Y105C probably damaging Het
Gm12588 T C 11: 121,906,168 Y285C probably benign Het
Gm21276 T A 7: 38,768,151 noncoding transcript Het
Kat2b A G 17: 53,610,904 N97S probably benign Het
Mus81 A G 19: 5,484,963 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pkhd1l1 C A 15: 44,560,506 A3148E possibly damaging Het
Prkar2b T C 12: 31,972,150 N212S probably benign Het
Rp1 T A 1: 4,348,013 T959S probably damaging Het
Samd4 G A 14: 46,884,842 G8R probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l-ps1 A G 17: 34,770,102 noncoding transcript Het
Vmn1r20 A G 6: 57,431,946 M86V possibly damaging Het
Vwa1 A G 4: 155,773,069 Y91H probably benign Het
Zan A G 5: 137,421,867 S2843P unknown Het
Zbtb39 A T 10: 127,741,581 Q8L possibly damaging Het
Other mutations in Olfr160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Olfr160 APN 9 37711836 missense probably damaging 0.98
IGL02195:Olfr160 APN 9 37712121 missense probably benign
R0099:Olfr160 UTSW 9 37711454 missense probably damaging 0.99
R0124:Olfr160 UTSW 9 37711463 missense possibly damaging 0.79
R0129:Olfr160 UTSW 9 37711940 missense probably damaging 1.00
R0882:Olfr160 UTSW 9 37711872 missense probably benign 0.02
R1855:Olfr160 UTSW 9 37711970 missense possibly damaging 0.92
R1988:Olfr160 UTSW 9 37711697 missense possibly damaging 0.50
R4164:Olfr160 UTSW 9 37711698 missense probably benign 0.03
R4274:Olfr160 UTSW 9 37712068 missense probably damaging 1.00
R4504:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R4505:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R4506:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R5017:Olfr160 UTSW 9 37711525 nonsense probably null
R5268:Olfr160 UTSW 9 37712004 missense probably damaging 1.00
R5316:Olfr160 UTSW 9 37711685 missense possibly damaging 0.90
R5372:Olfr160 UTSW 9 37711938 missense possibly damaging 0.49
R5385:Olfr160 UTSW 9 37712021 missense probably damaging 1.00
R5822:Olfr160 UTSW 9 37711791 missense probably benign 0.01
R5906:Olfr160 UTSW 9 37711805 missense probably benign 0.23
R5990:Olfr160 UTSW 9 37712110 missense probably damaging 0.99
R6842:Olfr160 UTSW 9 37711589 missense probably benign
R7712:Olfr160 UTSW 9 37712133 missense probably damaging 1.00
R8132:Olfr160 UTSW 9 37712073 missense probably benign 0.41
Z1177:Olfr160 UTSW 9 37711564 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCCTCTCAAGTAGTAATGCTG -3'
(R):5'- GGGCTTGTTCTATGGATCCAC -3'

Sequencing Primer
(F):5'- TCTCAAGTAGTAATGCTGATGTTTAG -3'
(R):5'- TGGATCCACAGCATTCATGTAC -3'
Posted On2014-10-30