Incidental Mutation 'R2346:Fbxw15'
ID245953
Institutional Source Beutler Lab
Gene Symbol Fbxw15
Ensembl Gene ENSMUSG00000074060
Gene NameF-box and WD-40 domain protein 15
SynonymsFbxo12J
MMRRC Submission 040329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2346 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109552602-109568262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109565432 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 105 (Y105C)
Ref Sequence ENSEMBL: ENSMUSP00000143385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056745] [ENSMUST00000198112] [ENSMUST00000198397]
Predicted Effect probably damaging
Transcript: ENSMUST00000056745
AA Change: Y105C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058175
Gene: ENSMUSG00000074060
AA Change: Y105C

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1flga_ 73 413 3e-7 SMART
Blast:WD40 137 176 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198112
SMART Domains Protein: ENSMUSP00000142894
Gene: ENSMUSG00000074060

DomainStartEndE-ValueType
FBOX 8 45 2.1e-6 SMART
SCOP:d1tbga_ 73 196 3e-5 SMART
Blast:WD40 84 123 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000198397
AA Change: Y105C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143385
Gene: ENSMUSG00000074060
AA Change: Y105C

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1tbga_ 116 240 1e-3 SMART
Blast:WD40 137 176 6e-6 BLAST
Meta Mutation Damage Score 0.7729 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (21/21)
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC051665 T C 13: 60,783,960 probably benign Het
Ces1a C T 8: 93,025,319 V396M probably benign Het
Dnm2 T C 9: 21,467,556 L137P probably damaging Het
Elf2 A G 3: 51,257,444 S380P probably benign Het
Gm12588 T C 11: 121,906,168 Y285C probably benign Het
Gm21276 T A 7: 38,768,151 noncoding transcript Het
Kat2b A G 17: 53,610,904 N97S probably benign Het
Mus81 A G 19: 5,484,963 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr160 T C 9: 37,711,365 R305G possibly damaging Het
Pkhd1l1 C A 15: 44,560,506 A3148E possibly damaging Het
Prkar2b T C 12: 31,972,150 N212S probably benign Het
Rp1 T A 1: 4,348,013 T959S probably damaging Het
Samd4 G A 14: 46,884,842 G8R probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l-ps1 A G 17: 34,770,102 noncoding transcript Het
Vmn1r20 A G 6: 57,431,946 M86V possibly damaging Het
Vwa1 A G 4: 155,773,069 Y91H probably benign Het
Zan A G 5: 137,421,867 S2843P unknown Het
Zbtb39 A T 10: 127,741,581 Q8L possibly damaging Het
Other mutations in Fbxw15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02094:Fbxw15 APN 9 109558240 missense possibly damaging 0.87
IGL02239:Fbxw15 APN 9 109559837 missense probably benign 0.01
IGL02343:Fbxw15 APN 9 109552655 utr 3 prime probably benign
IGL02748:Fbxw15 APN 9 109558210 missense possibly damaging 0.66
IGL03206:Fbxw15 APN 9 109565362 missense possibly damaging 0.90
IGL03370:Fbxw15 APN 9 109555151 missense probably benign 0.00
lagging UTSW 9 109555673 unclassified probably null
R0321:Fbxw15 UTSW 9 109565385 missense probably benign 0.03
R0742:Fbxw15 UTSW 9 109555556 splice site probably null
R1141:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1143:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1276:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1282:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1283:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1321:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1324:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1341:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1716:Fbxw15 UTSW 9 109557136 missense probably benign 0.00
R1750:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1757:Fbxw15 UTSW 9 109557279 missense probably damaging 0.99
R1765:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1799:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1826:Fbxw15 UTSW 9 109559714 splice site probably null
R1897:Fbxw15 UTSW 9 109558203 nonsense probably null
R2237:Fbxw15 UTSW 9 109555235 missense probably damaging 0.99
R4391:Fbxw15 UTSW 9 109568232 start gained probably benign
R4392:Fbxw15 UTSW 9 109568232 start gained probably benign
R4812:Fbxw15 UTSW 9 109559922 missense probably benign 0.01
R5198:Fbxw15 UTSW 9 109558174 missense probably benign 0.00
R5278:Fbxw15 UTSW 9 109555684 missense probably benign 0.03
R5541:Fbxw15 UTSW 9 109565430 missense probably benign 0.23
R5899:Fbxw15 UTSW 9 109555673 unclassified probably null
R5975:Fbxw15 UTSW 9 109555252 missense probably damaging 1.00
R6065:Fbxw15 UTSW 9 109568178 missense probably damaging 1.00
R6285:Fbxw15 UTSW 9 109557166 missense probably benign 0.09
R7357:Fbxw15 UTSW 9 109558240 missense probably benign 0.28
R7781:Fbxw15 UTSW 9 109557262 missense possibly damaging 0.71
R8145:Fbxw15 UTSW 9 109555590 missense probably benign 0.01
X0026:Fbxw15 UTSW 9 109558187 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCCTTTCAGAGATGGCTTAG -3'
(R):5'- AGCCTACAGTGTGCTTGGTG -3'

Sequencing Primer
(F):5'- CTACAGTTTTTAAGGGGCCTGACAC -3'
(R):5'- ACAGTGTGCTTGGTGGCCTC -3'
Posted On2014-10-30