Incidental Mutation 'R2346:Zbtb39'
ID245954
Institutional Source Beutler Lab
Gene Symbol Zbtb39
Ensembl Gene ENSMUSG00000044617
Gene Namezinc finger and BTB domain containing 39
Synonyms
MMRRC Submission 040329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R2346 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127739538-127747349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127741581 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 8 (Q8L)
Ref Sequence ENSEMBL: ENSMUSP00000052717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054287]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054287
AA Change: Q8L

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617
AA Change: Q8L

DomainStartEndE-ValueType
BTB 30 126 9.15e-24 SMART
low complexity region 197 206 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 372 394 6.4e0 SMART
ZnF_C2H2 400 420 3.21e1 SMART
ZnF_C2H2 451 474 9.31e1 SMART
ZnF_C2H2 480 502 6.92e0 SMART
ZnF_C2H2 508 530 1.79e-2 SMART
ZnF_C2H2 538 560 1.18e-2 SMART
ZnF_C2H2 605 627 2.57e-3 SMART
ZnF_C2H2 633 655 3.78e-1 SMART
ZnF_C2H2 661 683 2.49e-1 SMART
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (21/21)
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC051665 T C 13: 60,783,960 probably benign Het
Ces1a C T 8: 93,025,319 V396M probably benign Het
Dnm2 T C 9: 21,467,556 L137P probably damaging Het
Elf2 A G 3: 51,257,444 S380P probably benign Het
Fbxw15 T C 9: 109,565,432 Y105C probably damaging Het
Gm12588 T C 11: 121,906,168 Y285C probably benign Het
Gm21276 T A 7: 38,768,151 noncoding transcript Het
Kat2b A G 17: 53,610,904 N97S probably benign Het
Mus81 A G 19: 5,484,963 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr160 T C 9: 37,711,365 R305G possibly damaging Het
Pkhd1l1 C A 15: 44,560,506 A3148E possibly damaging Het
Prkar2b T C 12: 31,972,150 N212S probably benign Het
Rp1 T A 1: 4,348,013 T959S probably damaging Het
Samd4 G A 14: 46,884,842 G8R probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l-ps1 A G 17: 34,770,102 noncoding transcript Het
Vmn1r20 A G 6: 57,431,946 M86V possibly damaging Het
Vwa1 A G 4: 155,773,069 Y91H probably benign Het
Zan A G 5: 137,421,867 S2843P unknown Het
Other mutations in Zbtb39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zbtb39 APN 10 127742366 missense probably benign 0.00
R0636:Zbtb39 UTSW 10 127742835 missense probably benign 0.01
R0959:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R0959:Zbtb39 UTSW 10 127743062 missense probably damaging 1.00
R0962:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R0964:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1188:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1189:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1239:Zbtb39 UTSW 10 127743069 missense probably damaging 1.00
R1341:Zbtb39 UTSW 10 127743500 missense possibly damaging 0.91
R1838:Zbtb39 UTSW 10 127742700 missense probably damaging 1.00
R2012:Zbtb39 UTSW 10 127742834 missense probably benign 0.43
R2167:Zbtb39 UTSW 10 127742975 missense probably benign 0.03
R4041:Zbtb39 UTSW 10 127743554 missense probably damaging 1.00
R4171:Zbtb39 UTSW 10 127742367 missense possibly damaging 0.51
R4409:Zbtb39 UTSW 10 127742827 missense possibly damaging 0.51
R4410:Zbtb39 UTSW 10 127742827 missense possibly damaging 0.51
R4539:Zbtb39 UTSW 10 127742192 missense possibly damaging 0.90
R5761:Zbtb39 UTSW 10 127742646 missense probably damaging 1.00
R5766:Zbtb39 UTSW 10 127742688 missense probably damaging 1.00
R5812:Zbtb39 UTSW 10 127741560 start codon destroyed probably null 0.99
R6710:Zbtb39 UTSW 10 127743636 missense probably damaging 1.00
R6919:Zbtb39 UTSW 10 127741842 missense probably damaging 1.00
X0024:Zbtb39 UTSW 10 127741766 missense probably damaging 1.00
Z1177:Zbtb39 UTSW 10 127742427 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGCAGGGTGAAGGTCATTCC -3'
(R):5'- ATCTAGCCCAGTGTTTAAGAAGAG -3'

Sequencing Primer
(F):5'- GGTGAAGGTCATTCCCCACTC -3'
(R):5'- AGCCCAGTGTTTAAGAAGAGGTTCTG -3'
Posted On2014-10-30