Incidental Mutation 'R2346:Gm12588'
ID245957
Institutional Source Beutler Lab
Gene Symbol Gm12588
Ensembl Gene
Gene Namepredicted gene 12588
Synonyms
MMRRC Submission 040329-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2346 (G1)
Quality Score195
Status Validated
Chromosome11
Chromosomal Location121905675-121943034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121906168 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 285 (Y285C)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably benign
Transcript: ENSMUST00000142242
AA Change: Y285C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118445
Gene: ENSMUSG00000062632
AA Change: Y285C

DomainStartEndE-ValueType
KRAB 4 60 1.43e-10 SMART
ZnF_C2H2 131 153 5.77e0 SMART
ZnF_C2H2 159 181 5.9e-3 SMART
ZnF_C2H2 187 209 2.09e-3 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 2.43e-4 SMART
ZnF_C2H2 271 293 5.9e-3 SMART
ZnF_C2H2 299 321 2.95e-3 SMART
ZnF_C2H2 327 349 2.09e-3 SMART
ZnF_C2H2 355 377 2.79e-4 SMART
ZnF_C2H2 383 405 2.99e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (21/21)
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC051665 T C 13: 60,783,960 probably benign Het
Ces1a C T 8: 93,025,319 V396M probably benign Het
Dnm2 T C 9: 21,467,556 L137P probably damaging Het
Elf2 A G 3: 51,257,444 S380P probably benign Het
Fbxw15 T C 9: 109,565,432 Y105C probably damaging Het
Gm21276 T A 7: 38,768,151 noncoding transcript Het
Kat2b A G 17: 53,610,904 N97S probably benign Het
Mus81 A G 19: 5,484,963 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr160 T C 9: 37,711,365 R305G possibly damaging Het
Pkhd1l1 C A 15: 44,560,506 A3148E possibly damaging Het
Prkar2b T C 12: 31,972,150 N212S probably benign Het
Rp1 T A 1: 4,348,013 T959S probably damaging Het
Samd4 G A 14: 46,884,842 G8R probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l-ps1 A G 17: 34,770,102 noncoding transcript Het
Vmn1r20 A G 6: 57,431,946 M86V possibly damaging Het
Vwa1 A G 4: 155,773,069 Y91H probably benign Het
Zan A G 5: 137,421,867 S2843P unknown Het
Zbtb39 A T 10: 127,741,581 Q8L possibly damaging Het
Other mutations in Gm12588
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Gm12588 APN 11 121907951
IGL01966:Gm12588 APN 11 121906735 missense probably benign 0.16
IGL02234:Gm12588 APN 11 121908325
R3691:Gm12588 UTSW 11 121905925 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGTTTCTCTCCAGTGTGTTTTC -3'
(R):5'- GGAGAGAAGCCCTATGAATGTAA -3'

Sequencing Primer
(F):5'- TCTCCAGTGTGTTTTCTTTTATGTAC -3'
(R):5'- GCCTTTGCTCAGAACAGTGATC -3'
Posted On2014-10-30