Incidental Mutation 'R2346:Prkar2b'
ID245958
Institutional Source Beutler Lab
Gene Symbol Prkar2b
Ensembl Gene ENSMUSG00000002997
Gene Nameprotein kinase, cAMP dependent regulatory, type II beta
SynonymsRII(beta), Pkarb2, PKARIIbeta
MMRRC Submission 040329-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R2346 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31958476-32061296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31972150 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 212 (N212S)
Ref Sequence ENSEMBL: ENSMUSP00000039797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003079] [ENSMUST00000036497] [ENSMUST00000146865]
Predicted Effect probably benign
Transcript: ENSMUST00000003079
AA Change: N212S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000003079
Gene: ENSMUSG00000002997
AA Change: N212S

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036497
AA Change: N212S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000039797
Gene: ENSMUSG00000002997
AA Change: N212S

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146865
AA Change: N52S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135290
Gene: ENSMUSG00000002997
AA Change: N52S

DomainStartEndE-ValueType
cNMP 1 112 1.33e-15 SMART
cNMP 114 238 8.53e-28 SMART
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (21/21)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygou null mice are lean, weigh less than controls, and have reduced white fat pad size. Mice are resistant to both diet-induced obesity and to diet-induced insulin resistance. Mice show impaired coordination and increased sensitivity to chronic amphetamine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC051665 T C 13: 60,783,960 probably benign Het
Ces1a C T 8: 93,025,319 V396M probably benign Het
Dnm2 T C 9: 21,467,556 L137P probably damaging Het
Elf2 A G 3: 51,257,444 S380P probably benign Het
Fbxw15 T C 9: 109,565,432 Y105C probably damaging Het
Gm12588 T C 11: 121,906,168 Y285C probably benign Het
Gm21276 T A 7: 38,768,151 noncoding transcript Het
Kat2b A G 17: 53,610,904 N97S probably benign Het
Mus81 A G 19: 5,484,963 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr160 T C 9: 37,711,365 R305G possibly damaging Het
Pkhd1l1 C A 15: 44,560,506 A3148E possibly damaging Het
Rp1 T A 1: 4,348,013 T959S probably damaging Het
Samd4 G A 14: 46,884,842 G8R probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l-ps1 A G 17: 34,770,102 noncoding transcript Het
Vmn1r20 A G 6: 57,431,946 M86V possibly damaging Het
Vwa1 A G 4: 155,773,069 Y91H probably benign Het
Zan A G 5: 137,421,867 S2843P unknown Het
Zbtb39 A T 10: 127,741,581 Q8L possibly damaging Het
Other mutations in Prkar2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Prkar2b APN 12 32061072 missense possibly damaging 0.55
IGL02056:Prkar2b APN 12 31975910 splice site probably benign
IGL02071:Prkar2b APN 12 31963017 missense probably damaging 1.00
IGL02118:Prkar2b APN 12 31975964 missense probably damaging 1.00
spark UTSW 12 31987974 splice site probably null
R0211:Prkar2b UTSW 12 31972184 missense probably benign 0.30
R0362:Prkar2b UTSW 12 31987974 splice site probably null
R0485:Prkar2b UTSW 12 31976035 splice site probably benign
R0898:Prkar2b UTSW 12 31963002 missense possibly damaging 0.90
R1426:Prkar2b UTSW 12 31962988 splice site probably benign
R1997:Prkar2b UTSW 12 31963935 missense probably damaging 0.99
R2114:Prkar2b UTSW 12 31967280 missense probably damaging 1.00
R2513:Prkar2b UTSW 12 31975929 missense possibly damaging 0.93
R3875:Prkar2b UTSW 12 31965123 missense probably benign 0.01
R5301:Prkar2b UTSW 12 31975928 missense probably damaging 1.00
R5316:Prkar2b UTSW 12 32060985 missense probably damaging 0.97
R5351:Prkar2b UTSW 12 31972127 missense probably damaging 1.00
R6025:Prkar2b UTSW 12 32060856 missense possibly damaging 0.68
R6028:Prkar2b UTSW 12 31993758 missense possibly damaging 0.50
R6563:Prkar2b UTSW 12 31993786 splice site probably null
R7074:Prkar2b UTSW 12 31972148 missense probably damaging 1.00
R7431:Prkar2b UTSW 12 31963151 splice site probably null
R7747:Prkar2b UTSW 12 32060938 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATGCCAATGACTTGTGATCCC -3'
(R):5'- AGGCAGCATCAAGATTGCATTG -3'

Sequencing Primer
(F):5'- ACAGACTGGGGATATCTGCCTATC -3'
(R):5'- CATCAAGATTGCATTGCACGG -3'
Posted On2014-10-30