Mutagenetix > Incidental Mutation

Incidental Mutation 'R2346:Prkar2b'

245958

Institutional Source

Beutler Lab

Gene Symbol

Prkar2b

Ensembl Gene

ENSMUSG00000002997

Gene Name

protein kinase, cAMP dependent regulatory, type II beta

Synonyms

RII(beta), Pkarb2, PKARIIbeta

MMRRC Submission

040329-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.283) question?

Stock #

R2346 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32008475-32111295 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32022149 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 212 (N212S)

Ref Sequence

ENSEMBL: ENSMUSP00000039797 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003079] [ENSMUST00000036497] [ENSMUST00000146865]

AlphaFold

P31324

Predicted Effect

probably benign
Transcript: ENSMUST00000003079
AA Change: N212S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000003079
Gene: ENSMUSG00000002997
AA Change: N212S

Domain	Start	End	E-Value	Type
RIIa	7	44	7.78e-17	SMART
low complexity region	61	68	N/A	INTRINSIC
low complexity region	86	101	N/A	INTRINSIC
cNMP	152	272	7.2e-26	SMART
cNMP	274	398	8.53e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000036497
AA Change: N212S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000039797
Gene: ENSMUSG00000002997
AA Change: N212S

Domain	Start	End	E-Value	Type
RIIa	7	44	7.78e-17	SMART
low complexity region	61	68	N/A	INTRINSIC
low complexity region	86	101	N/A	INTRINSIC
cNMP	152	272	7.2e-26	SMART
cNMP	274	398	8.53e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146865
AA Change: N52S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135290
Gene: ENSMUSG00000002997
AA Change: N52S

Domain	Start	End	E-Value	Type
cNMP	1	112	1.33e-15	SMART
cNMP	114	238	8.53e-28	SMART

Meta Mutation Damage Score

0.0700

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (21/21)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygou null mice are lean, weigh less than controls, and have reduced white fat pad size. Mice are resistant to both diet-induced obesity and to diet-induced insulin resistance. Mice show impaired coordination and increased sensitivity to chronic amphetamine exposure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
BC051665	T	C	13: 60,931,774 (GRCm39)		probably benign	Het
Ces1a	C	T	8: 93,751,947 (GRCm39)	V396M	probably benign	Het
Dnm2	T	C	9: 21,378,852 (GRCm39)	L137P	probably damaging	Het
Elf2	A	G	3: 51,164,865 (GRCm39)	S380P	probably benign	Het
Fbxw15	T	C	9: 109,394,500 (GRCm39)	Y105C	probably damaging	Het
Gm12588	T	C	11: 121,796,994 (GRCm39)	Y285C	probably benign	Het
Gm21276	T	A	7: 38,467,575 (GRCm39)		noncoding transcript	Het
Kat2b	A	G	17: 53,917,932 (GRCm39)	N97S	probably benign	Het
Mus81	A	G	19: 5,534,991 (GRCm39)		probably benign	Het
Nfix	CAAAAA	CAAAA	8: 85,442,876 (GRCm39)		probably null	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Or8a1b	T	C	9: 37,622,661 (GRCm39)	R305G	possibly damaging	Het
Pkhd1l1	C	A	15: 44,423,902 (GRCm39)	A3148E	possibly damaging	Het
Rp1	T	A	1: 4,418,236 (GRCm39)	T959S	probably damaging	Het
Samd4	G	A	14: 47,122,299 (GRCm39)	G8R	probably damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Skiv2l-ps1	A	G	17: 34,989,076 (GRCm39)		noncoding transcript	Het
Vmn1r20	A	G	6: 57,408,931 (GRCm39)	M86V	possibly damaging	Het
Vwa1	A	G	4: 155,857,526 (GRCm39)	Y91H	probably benign	Het
Zan	A	G	5: 137,420,129 (GRCm39)	S2843P	unknown	Het
Zbtb39	A	T	10: 127,577,450 (GRCm39)	Q8L	possibly damaging	Het

Other mutations in Prkar2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01549:Prkar2b	APN	12	32,111,071 (GRCm39)	missense	possibly damaging	0.55
IGL02056:Prkar2b	APN	12	32,025,909 (GRCm39)	splice site	probably benign
IGL02071:Prkar2b	APN	12	32,013,016 (GRCm39)	missense	probably damaging	1.00
IGL02118:Prkar2b	APN	12	32,025,963 (GRCm39)	missense	probably damaging	1.00
spark	UTSW	12	32,037,973 (GRCm39)	splice site	probably null
R0211:Prkar2b	UTSW	12	32,022,183 (GRCm39)	missense	probably benign	0.30
R0362:Prkar2b	UTSW	12	32,037,973 (GRCm39)	splice site	probably null
R0485:Prkar2b	UTSW	12	32,026,034 (GRCm39)	splice site	probably benign
R0898:Prkar2b	UTSW	12	32,013,001 (GRCm39)	missense	possibly damaging	0.90
R1426:Prkar2b	UTSW	12	32,012,987 (GRCm39)	splice site	probably benign
R1997:Prkar2b	UTSW	12	32,013,934 (GRCm39)	missense	probably damaging	0.99
R2114:Prkar2b	UTSW	12	32,017,279 (GRCm39)	missense	probably damaging	1.00
R2513:Prkar2b	UTSW	12	32,025,928 (GRCm39)	missense	possibly damaging	0.93
R3875:Prkar2b	UTSW	12	32,015,122 (GRCm39)	missense	probably benign	0.01
R5301:Prkar2b	UTSW	12	32,025,927 (GRCm39)	missense	probably damaging	1.00
R5316:Prkar2b	UTSW	12	32,110,984 (GRCm39)	missense	probably damaging	0.97
R5351:Prkar2b	UTSW	12	32,022,126 (GRCm39)	missense	probably damaging	1.00
R6025:Prkar2b	UTSW	12	32,110,855 (GRCm39)	missense	possibly damaging	0.68
R6028:Prkar2b	UTSW	12	32,043,757 (GRCm39)	missense	possibly damaging	0.50
R6563:Prkar2b	UTSW	12	32,043,785 (GRCm39)	splice site	probably null
R7074:Prkar2b	UTSW	12	32,022,147 (GRCm39)	missense	probably damaging	1.00
R7431:Prkar2b	UTSW	12	32,013,150 (GRCm39)	splice site	probably null
R7747:Prkar2b	UTSW	12	32,110,937 (GRCm39)	missense	probably benign	0.23
R7978:Prkar2b	UTSW	12	32,013,024 (GRCm39)	missense	possibly damaging	0.81
R8926:Prkar2b	UTSW	12	32,111,080 (GRCm39)	start codon destroyed	probably null	0.99
R9102:Prkar2b	UTSW	12	32,013,025 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGCCAATGACTTGTGATCCC -3'
(R):5'- AGGCAGCATCAAGATTGCATTG -3'

Sequencing Primer
(F):5'- ACAGACTGGGGATATCTGCCTATC -3'
(R):5'- CATCAAGATTGCATTGCACGG -3'

Posted On

2014-10-30