Incidental Mutation 'R2345:Kynu'
ID245966
Institutional Source Beutler Lab
Gene Symbol Kynu
Ensembl Gene ENSMUSG00000026866
Gene Namekynureninase (L-kynurenine hydrolase)
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location43555329-43682715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43581385 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 71 (Y71S)
Ref Sequence ENSEMBL: ENSMUSP00000108445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028223] [ENSMUST00000050511] [ENSMUST00000112826]
Predicted Effect probably damaging
Transcript: ENSMUST00000028223
AA Change: Y71S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028223
Gene: ENSMUSG00000026866
AA Change: Y71S

DomainStartEndE-ValueType
Pfam:Aminotran_5 70 400 3.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050511
AA Change: Y71S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061775
Gene: ENSMUSG00000026866
AA Change: Y71S

DomainStartEndE-ValueType
Pfam:Aminotran_5 70 307 7.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112826
AA Change: Y71S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108445
Gene: ENSMUSG00000026866
AA Change: Y71S

DomainStartEndE-ValueType
Pfam:Aminotran_5 70 405 8.4e-17 PFAM
Meta Mutation Damage Score 0.9643 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Kynu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Kynu APN 2 43671382 missense possibly damaging 0.91
IGL01974:Kynu APN 2 43681340 unclassified probably benign
R0099:Kynu UTSW 2 43629053 critical splice donor site probably null
R0304:Kynu UTSW 2 43679881 missense probably damaging 0.99
R1681:Kynu UTSW 2 43679825 missense probably damaging 1.00
R1799:Kynu UTSW 2 43604157 missense possibly damaging 0.65
R2016:Kynu UTSW 2 43604277 nonsense probably null
R3085:Kynu UTSW 2 43602300 missense probably benign 0.00
R3825:Kynu UTSW 2 43681439 missense probably benign
R4091:Kynu UTSW 2 43679872 missense possibly damaging 0.94
R4241:Kynu UTSW 2 43681410 missense probably benign 0.00
R4594:Kynu UTSW 2 43679890 missense probably benign 0.00
R4673:Kynu UTSW 2 43679803 missense probably damaging 1.00
R4871:Kynu UTSW 2 43679818 missense possibly damaging 0.58
R5371:Kynu UTSW 2 43589394 missense probably benign 0.00
R6272:Kynu UTSW 2 43634989 missense probably benign 0.01
R6342:Kynu UTSW 2 43681451 missense probably benign 0.09
R6866:Kynu UTSW 2 43563110 nonsense probably null
R7203:Kynu UTSW 2 43681353 missense probably damaging 1.00
R8163:Kynu UTSW 2 43628954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCCATGTAAAATACAAAAGGTC -3'
(R):5'- ATATGCTAGGGTGTAACTTGTCC -3'

Sequencing Primer
(F):5'- GGTCAAATACTGTTCAGAGCCTG -3'
(R):5'- GCTAGGGTGTAACTTGTCCAAATCAG -3'
Posted On2014-10-30