Incidental Mutation 'R2345:Olfr1031'
ID245969
Institutional Source Beutler Lab
Gene Symbol Olfr1031
Ensembl Gene ENSMUSG00000043267
Gene Nameolfactory receptor 1031
SynonymsGA_x6K02T2Q125-47470765-47471775, MOR200-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85990304-85993704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85991822 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2 (T2A)
Ref Sequence ENSEMBL: ENSMUSP00000149225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050942] [ENSMUST00000056849] [ENSMUST00000216807]
Predicted Effect probably benign
Transcript: ENSMUST00000050942
AA Change: T2A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000059256
Gene: ENSMUSG00000043267
AA Change: T2A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-55 PFAM
Pfam:7tm_1 40 289 6.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216807
AA Change: T2A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Olfr1031
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Olfr1031 APN 2 85992386 missense probably damaging 1.00
IGL02475:Olfr1031 APN 2 85992032 missense probably benign 0.19
IGL03230:Olfr1031 APN 2 85992239 missense probably benign 0.00
IGL03405:Olfr1031 APN 2 85991886 missense possibly damaging 0.84
PIT4151001:Olfr1031 UTSW 2 85992194 missense probably damaging 0.96
PIT4366001:Olfr1031 UTSW 2 85992041 missense probably damaging 1.00
R0344:Olfr1031 UTSW 2 85992382 nonsense probably null
R1168:Olfr1031 UTSW 2 85992684 missense probably damaging 1.00
R1170:Olfr1031 UTSW 2 85992696 missense probably damaging 1.00
R2915:Olfr1031 UTSW 2 85992045 missense probably damaging 1.00
R3498:Olfr1031 UTSW 2 85992430 missense probably benign 0.43
R4058:Olfr1031 UTSW 2 85992232 missense possibly damaging 0.87
R4747:Olfr1031 UTSW 2 85991927 missense probably damaging 1.00
R4859:Olfr1031 UTSW 2 85992731 missense probably damaging 0.96
R4991:Olfr1031 UTSW 2 85992287 missense probably damaging 0.99
R5438:Olfr1031 UTSW 2 85992581 missense probably damaging 1.00
R6362:Olfr1031 UTSW 2 85991941 missense probably damaging 1.00
R7458:Olfr1031 UTSW 2 85992650 missense probably damaging 1.00
R7535:Olfr1031 UTSW 2 85991901 missense probably benign 0.37
R8807:Olfr1031 UTSW 2 85992828 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACTCAGAAGTCAAAGTTTGTTTGC -3'
(R):5'- TTGGAAGAGAAGCACATATCCAC -3'

Sequencing Primer
(F):5'- CAGAAGTCAAAGTTTGTTTGCTAATG -3'
(R):5'- TCCACAAAGGATAAGTGGCTC -3'
Posted On2014-10-30