Incidental Mutation 'R2345:Tox2'
ID245970
Institutional Source Beutler Lab
Gene Symbol Tox2
Ensembl Gene ENSMUSG00000074607
Gene NameTOX high mobility group box family member 2
SynonymsLOC269389, RxHMG1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location163203125-163324170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163319598 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 348 (Y348H)
Ref Sequence ENSEMBL: ENSMUSP00000096710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099110] [ENSMUST00000109428] [ENSMUST00000165937]
Predicted Effect probably damaging
Transcript: ENSMUST00000099110
AA Change: Y348H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096710
Gene: ENSMUSG00000074607
AA Change: Y348H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 20 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
HMG 287 357 1.44e-18 SMART
low complexity region 424 451 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 499 524 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109428
AA Change: Y306H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105055
Gene: ENSMUSG00000074607
AA Change: Y306H

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
HMG 245 315 1.44e-18 SMART
low complexity region 382 409 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
low complexity region 457 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148599
SMART Domains Protein: ENSMUSP00000118219
Gene: ENSMUSG00000074607

DomainStartEndE-ValueType
low complexity region 36 63 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165937
AA Change: Y313H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126243
Gene: ENSMUSG00000074607
AA Change: Y313H

DomainStartEndE-ValueType
low complexity region 75 87 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
HMG 252 322 1.44e-18 SMART
low complexity region 389 416 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Meta Mutation Damage Score 0.5708 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Tox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Tox2 APN 2 163225466 utr 5 prime probably benign
IGL01891:Tox2 APN 2 163322983 missense possibly damaging 0.48
IGL02190:Tox2 APN 2 163323006 missense possibly damaging 0.91
IGL02576:Tox2 APN 2 163276180 missense probably damaging 0.99
R0881:Tox2 UTSW 2 163321445 missense probably benign 0.18
R1739:Tox2 UTSW 2 163247785 missense probably damaging 0.99
R1742:Tox2 UTSW 2 163225526 missense probably benign 0.04
R1900:Tox2 UTSW 2 163276167 missense probably damaging 1.00
R1937:Tox2 UTSW 2 163225556 missense probably benign
R2842:Tox2 UTSW 2 163204630 intron probably benign
R3753:Tox2 UTSW 2 163314323 missense probably damaging 1.00
R4614:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4615:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4616:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4618:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4625:Tox2 UTSW 2 163314416 missense possibly damaging 0.71
R5410:Tox2 UTSW 2 163320373 missense probably benign 0.04
R5493:Tox2 UTSW 2 163204729 nonsense probably null
R6731:Tox2 UTSW 2 163320377 missense probably damaging 1.00
R6965:Tox2 UTSW 2 163323010 makesense probably null
R7038:Tox2 UTSW 2 163314344 missense probably damaging 0.99
R7078:Tox2 UTSW 2 163320581 missense
R7422:Tox2 UTSW 2 163321515 missense
R7577:Tox2 UTSW 2 163315902 nonsense probably null
R7829:Tox2 UTSW 2 163320376 missense probably damaging 1.00
R8356:Tox2 UTSW 2 163204630 missense unknown
R8456:Tox2 UTSW 2 163204630 missense unknown
R8754:Tox2 UTSW 2 163321440 missense
RF011:Tox2 UTSW 2 163225564 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCAATGCTCTCAAAAGAACTGG -3'
(R):5'- CAATCCCATGCTCACTGCTG -3'

Sequencing Primer
(F):5'- CTCTCAAAAGAACTGGGCCAGTG -3'
(R):5'- ATGCTCACTGCTGGGGTC -3'
Posted On2014-10-30