Incidental Mutation 'R2345:Ndst4'
ID245973
Institutional Source Beutler Lab
Gene Symbol Ndst4
Ensembl Gene ENSMUSG00000027971
Gene NameN-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location125404076-125728899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125708120 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 111 (S111P)
Ref Sequence ENSEMBL: ENSMUSP00000133575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173932] [ENSMUST00000174648] [ENSMUST00000198101]
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000173932
AA Change: S619P

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133341
Gene: ENSMUSG00000027971
AA Change: S619P

DomainStartEndE-ValueType
Pfam:HSNSD 20 505 1.2e-251 PFAM
Pfam:Sulfotransfer_1 594 857 1.2e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174648
AA Change: S111P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133575
Gene: ENSMUSG00000027971
AA Change: S111P

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 86 349 6.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198101
SMART Domains Protein: ENSMUSP00000142414
Gene: ENSMUSG00000027971

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 3 148 7e-22 PFAM
Meta Mutation Damage Score 0.1546 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a phenotype restricted to the colonic epithelium that includes an increased number of colon goblet cells, a decreased number of colonocytes, and increased apoptosis of colonic epithelial cells in the proximal colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Ndst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Ndst4 APN 3 125438211 missense probably damaging 0.98
IGL00926:Ndst4 APN 3 125561453 missense probably benign 0.01
IGL01292:Ndst4 APN 3 125438754 missense probably damaging 1.00
IGL01797:Ndst4 APN 3 125683153 missense probably damaging 0.99
R0004:Ndst4 UTSW 3 125570826 missense probably benign 0.03
R0118:Ndst4 UTSW 3 125611561 nonsense probably null
R0652:Ndst4 UTSW 3 125611539 missense possibly damaging 0.93
R1437:Ndst4 UTSW 3 125561450 missense probably damaging 0.97
R1502:Ndst4 UTSW 3 125437758 start gained probably benign
R1900:Ndst4 UTSW 3 125697895 splice site probably null
R1960:Ndst4 UTSW 3 125438682 nonsense probably null
R2249:Ndst4 UTSW 3 125438174 missense probably benign 0.16
R2334:Ndst4 UTSW 3 125708176 missense possibly damaging 0.86
R3617:Ndst4 UTSW 3 125438133 missense probably benign 0.00
R3713:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R3715:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R3954:Ndst4 UTSW 3 125437905 missense probably benign 0.01
R4013:Ndst4 UTSW 3 125683170 missense probably damaging 1.00
R4035:Ndst4 UTSW 3 125438736 missense probably damaging 1.00
R4085:Ndst4 UTSW 3 125609482 missense probably benign
R4496:Ndst4 UTSW 3 125683273 missense probably damaging 1.00
R4498:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R5187:Ndst4 UTSW 3 125437911 missense probably damaging 0.98
R5233:Ndst4 UTSW 3 125710117 missense probably damaging 1.00
R5518:Ndst4 UTSW 3 125438456 missense probably benign
R5575:Ndst4 UTSW 3 125437830 missense probably benign 0.41
R5687:Ndst4 UTSW 3 125438609 missense possibly damaging 0.79
R5940:Ndst4 UTSW 3 125561419 splice site probably benign
R6027:Ndst4 UTSW 3 125713376 missense probably benign 0.38
R6406:Ndst4 UTSW 3 125438501 missense probably benign
R6540:Ndst4 UTSW 3 125722152 nonsense probably null
R6941:Ndst4 UTSW 3 125609511 missense possibly damaging 0.93
R7108:Ndst4 UTSW 3 125561471 missense probably damaging 0.96
R7269:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R7278:Ndst4 UTSW 3 125438303 missense probably benign 0.00
R7345:Ndst4 UTSW 3 125714659 missense probably benign 0.07
R7405:Ndst4 UTSW 3 125683216 missense probably benign
R7418:Ndst4 UTSW 3 125708151 missense probably damaging 0.99
R7592:Ndst4 UTSW 3 125570787 missense probably damaging 0.99
R7714:Ndst4 UTSW 3 125570844 missense probably benign 0.08
X0027:Ndst4 UTSW 3 125437946 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATTCTGCATTGACTGTGCCTC -3'
(R):5'- TGCAGATGCCATGCACACATC -3'

Sequencing Primer
(F):5'- CATCCACTTTACTTTGGCTATGTAG -3'
(R):5'- GCCATGCACACATCTGTAATTG -3'
Posted On2014-10-30