Incidental Mutation 'R2345:Fbxw8'
ID245980
Institutional Source Beutler Lab
Gene Symbol Fbxw8
Ensembl Gene ENSMUSG00000032867
Gene NameF-box and WD-40 domain protein 8
SynonymsFbx29, FBW6, FBXO29, 4930438M06Rik, FBW8
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R2345 (G1)
Quality Score181
Status Validated
Chromosome5
Chromosomal Location118064965-118155464 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 118065807 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031304] [ENSMUST00000049474] [ENSMUST00000124648]
Predicted Effect probably benign
Transcript: ENSMUST00000031304
SMART Domains Protein: ENSMUSP00000031304
Gene: ENSMUSG00000029359

DomainStartEndE-ValueType
PDB:2CT9|B 1 212 2e-29 PDB
SCOP:d1auib_ 13 203 2e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031305
Predicted Effect probably benign
Transcript: ENSMUST00000049474
SMART Domains Protein: ENSMUSP00000047012
Gene: ENSMUSG00000032867

DomainStartEndE-ValueType
low complexity region 16 39 N/A INTRINSIC
low complexity region 51 75 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
FBOX 119 159 5e-5 SMART
WD40 198 236 6.16e0 SMART
WD40 248 285 7.1e1 SMART
WD40 289 327 7.36e1 SMART
Blast:WD40 373 418 2e-8 BLAST
WD40 421 461 1.6e0 SMART
WD40 464 501 2.15e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124648
SMART Domains Protein: ENSMUSP00000138436
Gene: ENSMUSG00000029359

DomainStartEndE-ValueType
PDB:2CT9|B 9 138 3e-19 PDB
SCOP:d1dgua_ 9 138 1e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151792
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains a WD-40 domain, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display partial late embryonic lethality with embryonic growth retardation and abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Fbxw8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Fbxw8 APN 5 118068097 missense probably benign 0.00
IGL00435:Fbxw8 APN 5 118068137 missense probably benign 0.01
IGL00674:Fbxw8 APN 5 118095593 missense possibly damaging 0.94
IGL01306:Fbxw8 APN 5 118113720 missense possibly damaging 0.88
IGL02389:Fbxw8 APN 5 118128955 missense possibly damaging 0.57
IGL02438:Fbxw8 APN 5 118095693 missense probably benign 0.09
IGL02553:Fbxw8 APN 5 118066060 unclassified probably benign
IGL02752:Fbxw8 APN 5 118142750 missense probably damaging 1.00
IGL02975:Fbxw8 APN 5 118077695 missense probably benign 0.02
IGL03177:Fbxw8 APN 5 118128980 splice site probably benign
IGL03333:Fbxw8 APN 5 118095595 missense possibly damaging 0.94
IGL03407:Fbxw8 APN 5 118142676 missense probably damaging 1.00
ANU23:Fbxw8 UTSW 5 118113720 missense possibly damaging 0.88
R0135:Fbxw8 UTSW 5 118070487 missense probably damaging 1.00
R0760:Fbxw8 UTSW 5 118065901 unclassified probably null
R1115:Fbxw8 UTSW 5 118077571 splice site probably benign
R1498:Fbxw8 UTSW 5 118065785 unclassified probably benign
R1689:Fbxw8 UTSW 5 118077617 missense probably damaging 0.97
R1897:Fbxw8 UTSW 5 118128876 missense probably benign 0.16
R2160:Fbxw8 UTSW 5 118124988 missense probably damaging 1.00
R3743:Fbxw8 UTSW 5 118113639 missense probably damaging 1.00
R3935:Fbxw8 UTSW 5 118095718 missense probably benign 0.38
R4910:Fbxw8 UTSW 5 118125027 splice site probably null
R5220:Fbxw8 UTSW 5 118095711 missense possibly damaging 0.69
R5628:Fbxw8 UTSW 5 118092557 missense probably damaging 1.00
R6161:Fbxw8 UTSW 5 118092675 missense possibly damaging 0.94
R6184:Fbxw8 UTSW 5 118113749 missense probably damaging 1.00
R6582:Fbxw8 UTSW 5 118124963 missense probably benign 0.28
R6617:Fbxw8 UTSW 5 118142666 critical splice donor site probably null
R6785:Fbxw8 UTSW 5 118092689 missense probably damaging 1.00
R7363:Fbxw8 UTSW 5 118124992 missense probably damaging 0.97
R7395:Fbxw8 UTSW 5 118068215 missense probably damaging 1.00
R7674:Fbxw8 UTSW 5 118124971 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGTTCCACTGTGCTGGAAG -3'
(R):5'- GGTGCACTAGGGAACTTCTC -3'

Sequencing Primer
(F):5'- ACTGTGCTGGAAGAGGCC -3'
(R):5'- AGAGGAGCACCAGCCTGTG -3'
Posted On2014-10-30