Incidental Mutation 'R2345:Kcnc1'
ID245982
Institutional Source Beutler Lab
Gene Symbol Kcnc1
Ensembl Gene ENSMUSG00000058975
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 1
SynonymsKv3.1, C230009H10Rik, Kcr2-1, KShIIIB, NGK2, KV4, Shaw
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46396497-46438704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46397946 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 90 (E90G)
Ref Sequence ENSEMBL: ENSMUSP00000124938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025202] [ENSMUST00000160433]
Predicted Effect probably damaging
Transcript: ENSMUST00000025202
AA Change: E90G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025202
Gene: ENSMUSG00000058975
AA Change: E90G

DomainStartEndE-ValueType
BTB 8 112 2.29e-15 SMART
low complexity region 125 149 N/A INTRINSIC
Pfam:Ion_trans 247 435 2.8e-34 PFAM
Pfam:Ion_trans_2 346 440 1.5e-12 PFAM
low complexity region 449 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160433
AA Change: E90G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124938
Gene: ENSMUSG00000058975
AA Change: E90G

DomainStartEndE-ValueType
BTB 8 112 2.29e-15 SMART
low complexity region 125 149 N/A INTRINSIC
Pfam:Ion_trans 189 447 6.9e-47 PFAM
Pfam:Ion_trans_2 347 440 1.4e-12 PFAM
low complexity region 449 464 N/A INTRINSIC
Meta Mutation Damage Score 0.9539 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of integral membrane proteins that mediate the voltage-dependent potassium ion permeability of excitable membranes. Alternative splicing is thought to result in two transcript variants encoding isoforms that differ at their C-termini. These isoforms have had conflicting names in the literature: the longer isoform has been called both "b" and "alpha", while the shorter isoform has been called both "a" and "beta" (PMIDs 1432046, 12091563). [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Kcnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Kcnc1 APN 7 46428099 missense possibly damaging 0.95
IGL01860:Kcnc1 APN 7 46428130 missense probably damaging 1.00
IGL02075:Kcnc1 APN 7 46427973 missense probably damaging 1.00
IGL02478:Kcnc1 APN 7 46435169 missense probably benign 0.18
Evanescent UTSW 7 46427959 missense probably damaging 1.00
wispy UTSW 7 46427397 missense probably damaging 1.00
R1438:Kcnc1 UTSW 7 46428267 missense possibly damaging 0.81
R1487:Kcnc1 UTSW 7 46397874 missense possibly damaging 0.88
R1487:Kcnc1 UTSW 7 46435348 critical splice donor site probably null
R1595:Kcnc1 UTSW 7 46427586 missense probably benign 0.03
R2273:Kcnc1 UTSW 7 46427802 missense probably damaging 1.00
R4126:Kcnc1 UTSW 7 46398002 missense probably damaging 0.98
R4387:Kcnc1 UTSW 7 46397702 missense possibly damaging 0.89
R4388:Kcnc1 UTSW 7 46397702 missense possibly damaging 0.89
R4508:Kcnc1 UTSW 7 46428288 missense probably benign 0.15
R4688:Kcnc1 UTSW 7 46397835 missense probably benign 0.01
R4784:Kcnc1 UTSW 7 46437287 missense probably benign 0.00
R5293:Kcnc1 UTSW 7 46397811 missense probably benign 0.01
R5993:Kcnc1 UTSW 7 46427532 missense probably damaging 1.00
R6296:Kcnc1 UTSW 7 46435316 missense probably benign 0.00
R6512:Kcnc1 UTSW 7 46427397 missense probably damaging 1.00
R6678:Kcnc1 UTSW 7 46397805 missense probably benign 0.30
R6801:Kcnc1 UTSW 7 46435292 missense probably damaging 0.99
R7232:Kcnc1 UTSW 7 46427959 missense probably damaging 1.00
R7886:Kcnc1 UTSW 7 46427621 missense probably damaging 1.00
R7899:Kcnc1 UTSW 7 46427821 missense probably damaging 1.00
R7969:Kcnc1 UTSW 7 46427621 missense probably damaging 1.00
R7982:Kcnc1 UTSW 7 46427821 missense probably damaging 1.00
R7998:Kcnc1 UTSW 7 46397799 missense probably benign 0.01
X0022:Kcnc1 UTSW 7 46435240 missense probably benign
X0054:Kcnc1 UTSW 7 46397892 missense probably damaging 1.00
Y5406:Kcnc1 UTSW 7 46427379 missense probably benign 0.00
Z1177:Kcnc1 UTSW 7 46397852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAAGACCCTAGGGAGCCC -3'
(R):5'- AGTCACTGAGTGCCAATCTCTTG -3'

Sequencing Primer
(F):5'- CGAGCGCATCGTGATCAAC -3'
(R):5'- AATCTCTTGGTCATCTCCAGC -3'
Posted On2014-10-30