Incidental Mutation 'R2345:Lonrf1'
ID245983
Institutional Source Beutler Lab
Gene Symbol Lonrf1
Ensembl Gene ENSMUSG00000039633
Gene NameLON peptidase N-terminal domain and ring finger 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location36216064-36249516 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 36222862 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065297] [ENSMUST00000065297]
Predicted Effect probably null
Transcript: ENSMUST00000065297
SMART Domains Protein: ENSMUSP00000066403
Gene: ENSMUSG00000039633

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 161 N/A INTRINSIC
RING 193 228 1.57e-2 SMART
SCOP:d1elwa_ 274 387 3e-16 SMART
Blast:TPR 309 342 1e-14 BLAST
Blast:TPR 343 376 2e-15 BLAST
low complexity region 454 464 N/A INTRINSIC
RING 543 580 3.12e-6 SMART
Pfam:LON_substr_bdg 631 830 8e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065297
SMART Domains Protein: ENSMUSP00000066403
Gene: ENSMUSG00000039633

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 161 N/A INTRINSIC
RING 193 228 1.57e-2 SMART
SCOP:d1elwa_ 274 387 3e-16 SMART
Blast:TPR 309 342 1e-14 BLAST
Blast:TPR 343 376 2e-15 BLAST
low complexity region 454 464 N/A INTRINSIC
RING 543 580 3.12e-6 SMART
Pfam:LON_substr_bdg 631 830 8e-30 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Lonrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lonrf1 APN 8 36230077 splice site probably benign
IGL02195:Lonrf1 APN 8 36219948 nonsense probably null
IGL03087:Lonrf1 APN 8 36225551 splice site probably null
IGL03163:Lonrf1 APN 8 36230330 missense probably benign 0.03
IGL03225:Lonrf1 APN 8 36222701 missense probably damaging 0.96
BB009:Lonrf1 UTSW 8 36222916 missense not run
BB019:Lonrf1 UTSW 8 36222916 missense not run
R0480:Lonrf1 UTSW 8 36222710 missense probably damaging 1.00
R0504:Lonrf1 UTSW 8 36231159 missense possibly damaging 0.93
R0557:Lonrf1 UTSW 8 36230420 missense probably benign 0.12
R1489:Lonrf1 UTSW 8 36222954 missense probably damaging 1.00
R1572:Lonrf1 UTSW 8 36233972 missense probably benign 0.02
R2225:Lonrf1 UTSW 8 36236098 missense probably damaging 0.98
R4821:Lonrf1 UTSW 8 36219972 missense probably benign
R4934:Lonrf1 UTSW 8 36233949 missense probably damaging 1.00
R5538:Lonrf1 UTSW 8 36223024 critical splice acceptor site probably null
R6124:Lonrf1 UTSW 8 36229200 missense probably damaging 0.97
R6485:Lonrf1 UTSW 8 36229134 critical splice donor site probably null
R6603:Lonrf1 UTSW 8 36222941 missense probably damaging 1.00
R6886:Lonrf1 UTSW 8 36229037 intron probably null
R7113:Lonrf1 UTSW 8 36230510 missense probably benign 0.01
R7689:Lonrf1 UTSW 8 36248764 nonsense probably null
R7711:Lonrf1 UTSW 8 36249221 missense probably damaging 1.00
R7743:Lonrf1 UTSW 8 36249052 missense possibly damaging 0.72
R8085:Lonrf1 UTSW 8 36248615 missense probably damaging 1.00
R8183:Lonrf1 UTSW 8 36222665 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACTCAATGTCTGCAGTGCAATATC -3'
(R):5'- TCTCCCTCAGCTTGACCAAG -3'

Sequencing Primer
(F):5'- TAGAACTCTGAACCGCTTCCC -3'
(R):5'- TCAGCTTGACCAAGAATGTCC -3'
Posted On2014-10-30