Incidental Mutation 'R2345:Olfr983'
ID245985
Institutional Source Beutler Lab
Gene Symbol Olfr983
Ensembl Gene ENSMUSG00000044205
Gene Nameolfactory receptor 983
SynonymsMOR162-1, GA_x6K02T2PVTD-33790948-33790013
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40086908-40093595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 40092553 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 138 (I138L)
Ref Sequence ENSEMBL: ENSMUSP00000083206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050996] [ENSMUST00000213087] [ENSMUST00000213858] [ENSMUST00000214856] [ENSMUST00000217536]
Predicted Effect probably benign
Transcript: ENSMUST00000050996
AA Change: I138L

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083206
Gene: ENSMUSG00000044205
AA Change: I138L

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2e-48 PFAM
Pfam:7TM_GPCR_Srsx 39 307 3.1e-5 PFAM
Pfam:7tm_1 45 293 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213087
AA Change: I134L

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000213858
Predicted Effect probably benign
Transcript: ENSMUST00000214856
Predicted Effect probably benign
Transcript: ENSMUST00000217536
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Olfr983
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Olfr983 APN 9 40092733 missense probably damaging 1.00
IGL01329:Olfr983 APN 9 40092028 missense possibly damaging 0.90
IGL01892:Olfr983 APN 9 40092818 missense probably damaging 1.00
IGL02712:Olfr983 APN 9 40092786 missense probably damaging 0.99
R0025:Olfr983 UTSW 9 40092253 missense probably damaging 1.00
R0066:Olfr983 UTSW 9 40092687 missense possibly damaging 0.74
R0136:Olfr983 UTSW 9 40092019 makesense probably null
R0715:Olfr983 UTSW 9 40092511 missense probably damaging 1.00
R3432:Olfr983 UTSW 9 40092549 missense probably damaging 1.00
R5027:Olfr983 UTSW 9 40092394 missense probably damaging 1.00
R6874:Olfr983 UTSW 9 40092726 missense probably benign 0.22
R7818:Olfr983 UTSW 9 40092712 missense probably damaging 1.00
R7823:Olfr983 UTSW 9 40092348 missense probably damaging 1.00
R8304:Olfr983 UTSW 9 40092354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAGGACAGCTTCAAGAG -3'
(R):5'- TCCTGTTGGGCTTGACACAG -3'

Sequencing Primer
(F):5'- CTTCAAGAGAGGGGGTATGTCACAC -3'
(R):5'- TTGACACAGCTGCCAGAG -3'
Posted On2014-10-30