Incidental Mutation 'R2345:Mfsd4b3'
ID245986
Institutional Source Beutler Lab
Gene Symbol Mfsd4b3
Ensembl Gene ENSMUSG00000071335
Gene Namemajor facilitator superfamily domain containing 4B3
SynonymsG630090E17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39946907-39960153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39948073 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 64 (M64L)
Ref Sequence ENSEMBL: ENSMUSP00000093420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095749]
Predicted Effect probably benign
Transcript: ENSMUST00000095749
AA Change: M64L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093420
Gene: ENSMUSG00000071335
AA Change: M64L

DomainStartEndE-ValueType
transmembrane domain 2 21 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
transmembrane domain 173 195 N/A INTRINSIC
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
transmembrane domain 297 319 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Mfsd4b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Mfsd4b3 APN 10 39948072 missense probably benign 0.30
IGL02903:Mfsd4b3 APN 10 39947643 missense possibly damaging 0.76
IGL02984:Mfsd4b3 APN 10 39947188 utr 3 prime probably benign
IGL03013:Mfsd4b3 APN 10 39947895 missense probably benign 0.00
R0322:Mfsd4b3 UTSW 10 39947530 missense probably damaging 0.99
R1238:Mfsd4b3 UTSW 10 39947226 missense probably damaging 0.97
R1750:Mfsd4b3 UTSW 10 39947933 missense probably benign
R4027:Mfsd4b3 UTSW 10 39947347 missense probably benign
R4906:Mfsd4b3 UTSW 10 39948060 missense probably damaging 1.00
R4965:Mfsd4b3 UTSW 10 39947690 nonsense probably null
R6456:Mfsd4b3 UTSW 10 39947320 missense probably benign 0.00
X0026:Mfsd4b3 UTSW 10 39947433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTAAAACATAGGTGCCGATGG -3'
(R):5'- TCTTTAGTGGCTGCCAACTC -3'

Sequencing Primer
(F):5'- CAGCAGATTCATGTCATCGGGTAC -3'
(R):5'- TTTAGTGGCTGCCAACTCCAAATAC -3'
Posted On2014-10-30