Incidental Mutation 'R2345:Elac2'
ID245987
Institutional Source Beutler Lab
Gene Symbol Elac2
Ensembl Gene ENSMUSG00000020549
Gene NameelaC ribonuclease Z 2
Synonyms1110017O07Rik, tRNase Z(L), D11Wsu80e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location64979038-65002069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65001074 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 773 (M773T)
Ref Sequence ENSEMBL: ENSMUSP00000104337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047463] [ENSMUST00000071891] [ENSMUST00000093002] [ENSMUST00000101049] [ENSMUST00000108697]
Predicted Effect probably benign
Transcript: ENSMUST00000047463
SMART Domains Protein: ENSMUSP00000039139
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 530 556 N/A INTRINSIC
low complexity region 561 575 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
low complexity region 664 689 N/A INTRINSIC
low complexity region 695 707 N/A INTRINSIC
low complexity region 716 746 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071891
AA Change: M774T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071788
Gene: ENSMUSG00000020549
AA Change: M774T

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 1.5e-16 PFAM
Lactamase_B 494 698 1.75e0 SMART
low complexity region 772 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093002
SMART Domains Protein: ENSMUSP00000090681
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 536 562 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 670 695 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 722 752 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101049
AA Change: M774T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098610
Gene: ENSMUSG00000020549
AA Change: M774T

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 3.1e-17 PFAM
Lactamase_B 494 698 1.75e0 SMART
low complexity region 772 791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108697
AA Change: M773T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104337
Gene: ENSMUSG00000020549
AA Change: M773T

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 9.8e-19 PFAM
Lactamase_B 493 697 1.75e0 SMART
low complexity region 771 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128693
Predicted Effect probably benign
Transcript: ENSMUST00000130420
SMART Domains Protein: ENSMUSP00000115612
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
Pfam:BAR 1 117 1.1e-29 PFAM
RhoGAP 141 317 1.07e-66 SMART
low complexity region 411 437 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 545 570 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 597 627 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140369
Meta Mutation Damage Score 0.1504 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a C-terminal domain with tRNA 3′ processing endoribonuclease activity, which catalyzes the removal of the 3' trailer from precursor tRNAs. The protein also interacts with activated Smad family member 2 (Smad2) and its nuclear partner forkhead box H1 (also known as FAST-1), and reduced expression can suppress transforming growth factor-beta induced growth arrest. Mutations in this gene result in an increased risk of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Elac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Elac2 APN 11 64980650 missense possibly damaging 0.92
IGL02035:Elac2 APN 11 65001835 missense probably benign
IGL02407:Elac2 APN 11 64999175 missense probably benign 0.01
R0329:Elac2 UTSW 11 64979310 missense probably damaging 1.00
R0360:Elac2 UTSW 11 64979310 missense probably damaging 1.00
R0364:Elac2 UTSW 11 64979310 missense probably damaging 1.00
R0526:Elac2 UTSW 11 64999436 missense probably benign 0.07
R0729:Elac2 UTSW 11 64998523 missense possibly damaging 0.62
R1912:Elac2 UTSW 11 64994263 missense probably benign
R1929:Elac2 UTSW 11 64979189 missense probably benign 0.00
R4765:Elac2 UTSW 11 64992222 missense probably damaging 1.00
R4828:Elac2 UTSW 11 64995327 missense probably damaging 1.00
R5000:Elac2 UTSW 11 64985553 missense probably benign
R5109:Elac2 UTSW 11 64992316 missense probably damaging 1.00
R5391:Elac2 UTSW 11 64994294 missense probably benign
R5865:Elac2 UTSW 11 64997957 missense probably benign 0.39
R5953:Elac2 UTSW 11 64999223 missense probably benign 0.00
R6800:Elac2 UTSW 11 64999439 critical splice donor site probably null
R6829:Elac2 UTSW 11 64989364 missense probably benign
R6870:Elac2 UTSW 11 64999763 missense probably null 1.00
R7037:Elac2 UTSW 11 64983711 missense probably benign
R7869:Elac2 UTSW 11 64999387 missense probably damaging 0.99
R7952:Elac2 UTSW 11 64999387 missense probably damaging 0.99
X0020:Elac2 UTSW 11 64987458 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTCCATTGGTCTGAGGGAATAC -3'
(R):5'- AGGTGACAGATGTGGCTTCC -3'

Sequencing Primer
(F):5'- CATTGGTCTGAGGGAATACAAGCAAG -3'
(R):5'- AGCCTACAGTCCAGGATGG -3'
Posted On2014-10-30