Incidental Mutation 'R2345:Plekhh1'
ID245990
Institutional Source Beutler Lab
Gene Symbol Plekhh1
Ensembl Gene ENSMUSG00000060716
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location79029163-79081655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79053647 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 130 (I130F)
Ref Sequence ENSEMBL: ENSMUSP00000151747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039928] [ENSMUST00000217954] [ENSMUST00000219956]
Predicted Effect probably damaging
Transcript: ENSMUST00000039928
AA Change: I130F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049460
Gene: ENSMUSG00000060716
AA Change: I130F

DomainStartEndE-ValueType
coiled coil region 26 172 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
PH 573 668 1.15e-22 SMART
PH 682 792 3.23e-8 SMART
MyTH4 826 980 3e-48 SMART
B41 987 1224 6.07e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217954
Predicted Effect probably damaging
Transcript: ENSMUST00000219956
AA Change: I130F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2115 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Plekhh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Plekhh1 APN 12 79078964 missense probably benign 0.35
IGL01764:Plekhh1 APN 12 79054905 missense probably benign 0.00
IGL01922:Plekhh1 APN 12 79079579 missense probably benign
IGL02187:Plekhh1 APN 12 79072818 missense probably damaging 1.00
IGL02406:Plekhh1 APN 12 79069009 splice site probably benign
IGL02581:Plekhh1 APN 12 79079108 critical splice donor site probably null
IGL03201:Plekhh1 APN 12 79053656 missense probably damaging 1.00
R0088:Plekhh1 UTSW 12 79055366 missense probably benign 0.00
R0626:Plekhh1 UTSW 12 79040585 nonsense probably null
R0662:Plekhh1 UTSW 12 79078993 missense probably benign 0.09
R0666:Plekhh1 UTSW 12 79069115 missense probably damaging 0.99
R0966:Plekhh1 UTSW 12 79065730 missense probably damaging 1.00
R1027:Plekhh1 UTSW 12 79054482 splice site probably benign
R1507:Plekhh1 UTSW 12 79079450 missense probably damaging 1.00
R1562:Plekhh1 UTSW 12 79076708 missense probably benign 0.00
R1759:Plekhh1 UTSW 12 79072761 missense probably damaging 1.00
R1839:Plekhh1 UTSW 12 79078957 splice site probably benign
R2125:Plekhh1 UTSW 12 79079000 missense probably damaging 1.00
R3895:Plekhh1 UTSW 12 79055232 missense probably benign
R3927:Plekhh1 UTSW 12 79053648 missense probably damaging 1.00
R4039:Plekhh1 UTSW 12 79055183 missense probably benign 0.01
R4720:Plekhh1 UTSW 12 79075420 frame shift probably null
R4721:Plekhh1 UTSW 12 79075420 frame shift probably null
R4824:Plekhh1 UTSW 12 79054803 missense probably benign
R4869:Plekhh1 UTSW 12 79050386 missense probably benign
R5114:Plekhh1 UTSW 12 79069106 missense probably benign 0.00
R5809:Plekhh1 UTSW 12 79078687 missense probably benign 0.26
R6540:Plekhh1 UTSW 12 79064489 missense probably benign 0.14
R6977:Plekhh1 UTSW 12 79065717 missense probably damaging 1.00
R7058:Plekhh1 UTSW 12 79075430 missense probably damaging 1.00
R7103:Plekhh1 UTSW 12 79066655 missense probably benign 0.01
R7120:Plekhh1 UTSW 12 79070939 missense probably benign 0.03
R7134:Plekhh1 UTSW 12 79062616 missense probably benign 0.00
R7209:Plekhh1 UTSW 12 79050376 missense probably benign 0.04
R7403:Plekhh1 UTSW 12 79040577 nonsense probably null
R7405:Plekhh1 UTSW 12 79055047 missense probably benign 0.00
R7449:Plekhh1 UTSW 12 79079552 missense probably benign 0.00
R7594:Plekhh1 UTSW 12 79076503 missense possibly damaging 0.89
R7648:Plekhh1 UTSW 12 79055131 missense probably benign 0.20
R7756:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
R7758:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
R8033:Plekhh1 UTSW 12 79070936 missense probably benign 0.23
R8129:Plekhh1 UTSW 12 79073438 missense probably damaging 0.99
R8153:Plekhh1 UTSW 12 79079038 missense probably benign 0.00
R8243:Plekhh1 UTSW 12 79079069 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCCCTTCCCACTTGAACTTTG -3'
(R):5'- CTTCTGGAAGGCTGACCCAG -3'

Sequencing Primer
(F):5'- CCCCTAAGTACTGAGACTTGAAGTG -3'
(R):5'- GGCTGACCCAGACAAAAGG -3'
Posted On2014-10-30