Incidental Mutation 'R2345:Atxn3'
ID245991
Institutional Source Beutler Lab
Gene Symbol Atxn3
Ensembl Gene ENSMUSG00000021189
Gene Nameataxin 3
SynonymsSca3, ataxin-3, Atx3, MJD1, 2210008M02Rik, Mjd
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location101918901-101958246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101948321 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 48 (M48K)
Ref Sequence ENSEMBL: ENSMUSP00000021606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021606] [ENSMUST00000159883] [ENSMUST00000160251] [ENSMUST00000161011]
Predicted Effect probably damaging
Transcript: ENSMUST00000021606
AA Change: M48K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021606
Gene: ENSMUSG00000021189
AA Change: M48K

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 1.51e-3 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
UIM 329 348 7.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159883
AA Change: M45K

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124419
Gene: ENSMUSG00000021189
AA Change: M45K

DomainStartEndE-ValueType
Josephin 5 164 1.1e-89 SMART
UIM 220 239 2.23e-1 SMART
UIM 240 259 1.51e-3 SMART
low complexity region 272 282 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160251
AA Change: M48K

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125082
Gene: ENSMUSG00000021189
AA Change: M48K

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 8.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161011
AA Change: M48K

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125378
Gene: ENSMUSG00000021189
AA Change: M48K

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 1.51e-3 SMART
low complexity region 276 286 N/A INTRINSIC
Meta Mutation Damage Score 0.7412 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Decreased exploratory behavior is reported for mice homozygous for a disruption of this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Ckb G A 12: 111,671,804 T52I probably damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Atxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Atxn3 APN 12 101926508 missense possibly damaging 0.94
IGL01364:Atxn3 APN 12 101934423 splice site probably benign
IGL01393:Atxn3 APN 12 101933047 nonsense probably null
IGL01994:Atxn3 APN 12 101942180 missense probably benign
IGL03214:Atxn3 APN 12 101945922 splice site probably benign
R1081:Atxn3 UTSW 12 101934349 missense probably damaging 0.98
R1255:Atxn3 UTSW 12 101934334 missense probably damaging 1.00
R1288:Atxn3 UTSW 12 101942178 synonymous probably null
R1435:Atxn3 UTSW 12 101942201 missense probably benign 0.18
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R2032:Atxn3 UTSW 12 101942194 nonsense probably null
R2882:Atxn3 UTSW 12 101937411 missense probably damaging 1.00
R4593:Atxn3 UTSW 12 101923177 missense probably benign 0.01
R4628:Atxn3 UTSW 12 101923078 unclassified probably benign
R4849:Atxn3 UTSW 12 101934368 missense probably benign 0.02
R4876:Atxn3 UTSW 12 101948379 missense probably damaging 1.00
R4960:Atxn3 UTSW 12 101948379 missense possibly damaging 0.92
R5682:Atxn3 UTSW 12 101958147 missense probably damaging 1.00
R6010:Atxn3 UTSW 12 101948026 missense probably damaging 1.00
R6520:Atxn3 UTSW 12 101934401 missense probably damaging 1.00
R6629:Atxn3 UTSW 12 101937406 missense probably benign 0.11
R7460:Atxn3 UTSW 12 101926517 missense probably benign 0.15
R7546:Atxn3 UTSW 12 101948002 critical splice donor site probably null
X0061:Atxn3 UTSW 12 101958139 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATTTCCCAAGTGAGGAGGAG -3'
(R):5'- GCATGGGGCTTACAAAGTTTG -3'

Sequencing Primer
(F):5'- AGCAGAGTGATAATTACCGAGTC -3'
(R):5'- GCTTACAAAGTTTGTTTTGACTGCC -3'
Posted On2014-10-30