Incidental Mutation 'R2345:Ckb'
ID245992
Institutional Source Beutler Lab
Gene Symbol Ckb
Ensembl Gene ENSMUSG00000001270
Gene Namecreatine kinase, brain
SynonymsB-CK, Ck-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2345 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111669361-111672338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111671804 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 52 (T52I)
Ref Sequence ENSEMBL: ENSMUSP00000001304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001304]
Predicted Effect probably damaging
Transcript: ENSMUST00000001304
AA Change: T52I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001304
Gene: ENSMUSG00000001270
AA Change: T52I

DomainStartEndE-ValueType
Pfam:ATP-gua_PtransN 24 99 1.9e-36 PFAM
Pfam:ATP-gua_Ptrans 120 367 1.9e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223099
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in brain as well as in other tissues, and as a heterodimer with a similar muscle isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. A pseudogene of this gene has been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have abnormal hippocampal morphology with enlarged mossy fiber field size and display resistance to pharmacologically induced seizures, reduced habituation and spatial learning impairments. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,948,321 M48K probably damaging Het
Bnc2 T C 4: 84,292,503 E638G probably damaging Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Ceacam3 T G 7: 17,155,000 D231E possibly damaging Het
Elac2 T C 11: 65,001,074 M773T probably damaging Het
Fbxw8 A T 5: 118,065,807 probably benign Het
Hk3 T C 13: 55,008,993 D582G probably damaging Het
Htt T A 5: 34,826,004 N982K possibly damaging Het
Jag2 T C 12: 112,909,064 E1190G probably damaging Het
Kcnc1 A G 7: 46,397,946 E90G probably damaging Het
Kynu A C 2: 43,581,385 Y71S probably damaging Het
Lonrf1 A T 8: 36,222,862 probably null Het
Mfsd4b3 T A 10: 39,948,073 M64L probably benign Het
Nbea A T 3: 56,085,279 F302Y probably damaging Het
Ndst4 T C 3: 125,708,120 S111P possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1031 A G 2: 85,991,822 T2A probably benign Het
Olfr161 G A 16: 3,593,139 V248M probably damaging Het
Olfr983 T G 9: 40,092,553 I138L probably benign Het
Phf3 G T 1: 30,805,351 S1509* probably null Het
Plekhh1 A T 12: 79,053,647 I130F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Szt2 A G 4: 118,381,397 F1953S unknown Het
Togaram1 T A 12: 65,008,632 S1466T probably benign Het
Tox2 T C 2: 163,319,598 Y348H probably damaging Het
Vmn2r-ps159 T A 4: 156,337,039 noncoding transcript Het
Wdr90 G T 17: 25,859,162 H411N probably benign Het
Yme1l1 C T 2: 23,194,786 T632I probably damaging Het
Other mutations in Ckb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Ckb APN 12 111669981 missense possibly damaging 0.94
R0179:Ckb UTSW 12 111670176 missense probably benign 0.00
R0686:Ckb UTSW 12 111670193 missense probably benign 0.42
R1065:Ckb UTSW 12 111671247 missense probably benign 0.07
R1311:Ckb UTSW 12 111669645 small deletion probably benign
R1481:Ckb UTSW 12 111671262 missense probably benign 0.05
R1888:Ckb UTSW 12 111669645 small deletion probably benign
R1888:Ckb UTSW 12 111669645 small deletion probably benign
R1891:Ckb UTSW 12 111669645 small deletion probably benign
R4936:Ckb UTSW 12 111671230 missense probably benign 0.14
R5934:Ckb UTSW 12 111670229 missense probably damaging 1.00
R6149:Ckb UTSW 12 111671814 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACAGTCATGATGTACGGGTGG -3'
(R):5'- GGCCGGTGTTTAAATCTCCTC -3'

Sequencing Primer
(F):5'- ACGTCACCGTCAGGCAG -3'
(R):5'- CGGTGTTTAAATCTCCTCTGACC -3'
Posted On2014-10-30