Incidental Mutation 'R2347:Olfr1263'
ID 245999
Institutional Source Beutler Lab
Gene Symbol Olfr1263
Ensembl Gene ENSMUSG00000059112
Gene Name olfactory receptor 1263
Synonyms MOR234-2, GA_x6K02T2Q125-51447049-51447969
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R2347 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 90012131-90018424 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 90015614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 228 (R228L)
Ref Sequence ENSEMBL: ENSMUSP00000150959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111507] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]
AlphaFold Q8VG63
Predicted Effect possibly damaging
Transcript: ENSMUST00000111507
AA Change: R228L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107132
Gene: ENSMUSG00000059112
AA Change: R228L

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 7.6e-42 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.7e-5 PFAM
Pfam:7tm_1 36 282 2.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214382
AA Change: R228L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000216616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216764
Predicted Effect possibly damaging
Transcript: ENSMUST00000217065
AA Change: R228L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1a C T 8: 93,025,319 V396M probably benign Het
Ddx6 A G 9: 44,607,591 K67E probably benign Het
Fut2 T C 7: 45,650,328 D340G probably damaging Het
Gm128 A G 3: 95,240,930 Y18H probably benign Het
Gon4l A G 3: 88,863,517 D502G probably damaging Het
Lman2 T A 13: 55,352,999 N129I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr527 T A 7: 140,336,147 M95K probably damaging Het
Olfr935 A T 9: 38,994,509 *309K probably null Het
Pappa2 C A 1: 158,765,043 C1588F probably damaging Het
Piwil2 T C 14: 70,408,917 D390G probably damaging Het
Rest A G 5: 77,268,593 Y218C probably damaging Het
Other mutations in Olfr1263
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Olfr1263 APN 2 90015719 missense probably damaging 1.00
IGL01512:Olfr1263 APN 2 90015292 missense probably damaging 1.00
IGL01722:Olfr1263 APN 2 90015007 missense probably benign 0.39
IGL01787:Olfr1263 APN 2 90015311 missense probably damaging 1.00
IGL02376:Olfr1263 APN 2 90015460 missense probably benign 0.00
IGL03408:Olfr1263 APN 2 90015571 missense probably benign 0.35
R0367:Olfr1263 UTSW 2 90015772 missense probably damaging 0.99
R0765:Olfr1263 UTSW 2 90015670 missense probably benign 0.01
R1158:Olfr1263 UTSW 2 90015254 missense possibly damaging 0.94
R1705:Olfr1263 UTSW 2 90015511 missense possibly damaging 0.90
R1794:Olfr1263 UTSW 2 90015020 missense probably damaging 1.00
R2197:Olfr1263 UTSW 2 90015424 missense probably damaging 1.00
R2442:Olfr1263 UTSW 2 90015341 missense probably benign
R3160:Olfr1263 UTSW 2 90015021 nonsense probably null
R3162:Olfr1263 UTSW 2 90015021 nonsense probably null
R4298:Olfr1263 UTSW 2 90015649 missense probably benign 0.13
R4898:Olfr1263 UTSW 2 90015418 missense probably damaging 1.00
R5340:Olfr1263 UTSW 2 90015362 missense probably benign
R6280:Olfr1263 UTSW 2 90015049 missense possibly damaging 0.62
R6367:Olfr1263 UTSW 2 90015016 missense probably benign 0.00
R6556:Olfr1263 UTSW 2 90015094 missense probably damaging 1.00
R7086:Olfr1263 UTSW 2 90015250 missense probably benign 0.07
R7502:Olfr1263 UTSW 2 90015011 missense probably benign 0.15
R7585:Olfr1263 UTSW 2 90015049 missense probably damaging 0.99
R7963:Olfr1263 UTSW 2 90015659 missense possibly damaging 0.73
R8062:Olfr1263 UTSW 2 90015736 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGGCCCAGTTACCCTTCTG -3'
(R):5'- GACCCCAGAGCTTCTTCATAAC -3'

Sequencing Primer
(F):5'- CCCAATACCATCAACCATTTTATGTG -3'
(R):5'- AGAGCTTCTTCATAACCCTTTTGAC -3'
Posted On 2014-10-30