Mutagenetix > Incidental Mutations

Incidental Mutation 'R2347:Gon4l'

246001

Institutional Source

Beutler Lab

Gene Symbol

Gon4l

Ensembl Gene

ENSMUSG00000054199

Gene Name

gon-4-like (C.elegans)

Synonyms

2610100B20Rik, 1500041I23Rik

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.748) question?

Stock #

R2347 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88835231-88910103 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88863517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 502 (D502G)

Ref Sequence

ENSEMBL: ENSMUSP00000088461 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000081695
AA Change: D501G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: D501G

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082804

Predicted Effect

probably damaging
Transcript: ENSMUST00000090942
AA Change: D502G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: D502G

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	241	257	N/A	INTRINSIC
low complexity region	349	378	N/A	INTRINSIC
low complexity region	433	440	N/A	INTRINSIC
low complexity region	528	543	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
Blast:SANT	814	866	2e-23	BLAST
low complexity region	962	976	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1419	1435	N/A	INTRINSIC
low complexity region	1453	1498	N/A	INTRINSIC
low complexity region	1508	1542	N/A	INTRINSIC
Pfam:PAH	1654	1700	2.1e-8	PFAM
low complexity region	1801	1812	N/A	INTRINSIC
coiled coil region	1920	1944	N/A	INTRINSIC
low complexity region	2086	2095	N/A	INTRINSIC
SANT	2154	2205	2.2e-1	SMART
low complexity region	2208	2223	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107498
AA Change: D501G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: D501G

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198251

Predicted Effect

unknown
Transcript: ENSMUST00000212694
AA Change: D209G

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ces1a	C	T	8: 93,025,319	V396M	probably benign	Het
Ddx6	A	G	9: 44,607,591	K67E	probably benign	Het
Fut2	T	C	7: 45,650,328	D340G	probably damaging	Het
Gm128	A	G	3: 95,240,930	Y18H	probably benign	Het
Lman2	T	A	13: 55,352,999	N129I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1263	G	T	2: 90,015,614	R228L	possibly damaging	Het
Olfr527	T	A	7: 140,336,147	M95K	probably damaging	Het
Olfr935	A	T	9: 38,994,509	*309K	probably null	Het
Pappa2	C	A	1: 158,765,043	C1588F	probably damaging	Het
Piwil2	T	C	14: 70,408,917	D390G	probably damaging	Het
Rest	A	G	5: 77,268,593	Y218C	probably damaging	Het

Other mutations in Gon4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00870:Gon4l	APN	3	88857185	missense	probably damaging	1.00
IGL02002:Gon4l	APN	3	88895336	missense	possibly damaging	0.46
IGL02065:Gon4l	APN	3	88857210	missense	probably null	1.00
IGL02283:Gon4l	APN	3	88895364	missense	probably damaging	0.99
IGL02669:Gon4l	APN	3	88895499	missense	probably damaging	1.00
IGL03222:Gon4l	APN	3	88895643	missense	possibly damaging	0.56
IGL03385:Gon4l	APN	3	88907543	missense	probably benign	0.10
PIT4581001:Gon4l	UTSW	3	88895514	missense	probably damaging	1.00
R0020:Gon4l	UTSW	3	88858937	missense	probably damaging	1.00
R0115:Gon4l	UTSW	3	88895682	missense	probably damaging	1.00
R0173:Gon4l	UTSW	3	88858403	missense	probably damaging	1.00
R0270:Gon4l	UTSW	3	88858400	missense	probably damaging	1.00
R0961:Gon4l	UTSW	3	88898096	splice site	probably benign
R1017:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R1163:Gon4l	UTSW	3	88892535	missense	probably damaging	1.00
R1729:Gon4l	UTSW	3	88903098	missense	probably damaging	1.00
R1764:Gon4l	UTSW	3	88892599	missense	probably damaging	1.00
R1861:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R2141:Gon4l	UTSW	3	88887595	missense	possibly damaging	0.66
R2402:Gon4l	UTSW	3	88859043	missense	probably damaging	1.00
R2842:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R4375:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4376:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4377:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4569:Gon4l	UTSW	3	88910090	intron	probably benign
R4650:Gon4l	UTSW	3	88863552	missense	possibly damaging	0.94
R4859:Gon4l	UTSW	3	88895348	missense	probably benign	0.00
R4901:Gon4l	UTSW	3	88908151	missense	possibly damaging	0.50
R4998:Gon4l	UTSW	3	88899998	missense	probably damaging	1.00
R5059:Gon4l	UTSW	3	88900012	missense	probably benign	0.00
R5217:Gon4l	UTSW	3	88887575	missense	probably damaging	1.00
R5269:Gon4l	UTSW	3	88895528	missense	probably benign
R5279:Gon4l	UTSW	3	88887637	missense	probably benign
R5283:Gon4l	UTSW	3	88887590	missense	probably damaging	1.00
R5386:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R5433:Gon4l	UTSW	3	88896225	missense	possibly damaging	0.93
R5583:Gon4l	UTSW	3	88899971	missense	probably damaging	1.00
R5695:Gon4l	UTSW	3	88896216	frame shift	probably null
R5921:Gon4l	UTSW	3	88909947	intron	probably benign
R6003:Gon4l	UTSW	3	88896093	missense	probably damaging	0.99
R6063:Gon4l	UTSW	3	88899999	missense	probably damaging	1.00
R6217:Gon4l	UTSW	3	88892661	missense	possibly damaging	0.62
R6273:Gon4l	UTSW	3	88855849	missense	probably damaging	1.00
R6280:Gon4l	UTSW	3	88890888	missense	probably damaging	1.00
R6790:Gon4l	UTSW	3	88858998	missense	probably damaging	1.00
R6829:Gon4l	UTSW	3	88880106	missense	possibly damaging	0.96
R6891:Gon4l	UTSW	3	88858866	splice site	probably null
R7128:Gon4l	UTSW	3	88895692	missense	possibly damaging	0.94
R7315:Gon4l	UTSW	3	88895179	missense	probably benign	0.00
R7355:Gon4l	UTSW	3	88863520	missense	probably damaging	1.00
R7426:Gon4l	UTSW	3	88907522	missense	probably benign
R7635:Gon4l	UTSW	3	88895106	missense	probably benign	0.03
R7643:Gon4l	UTSW	3	88902807	missense	probably damaging	1.00
R7715:Gon4l	UTSW	3	88908006	missense	probably benign
R7773:Gon4l	UTSW	3	88895795	missense	probably benign	0.00
R8090:Gon4l	UTSW	3	88892624	missense	probably damaging	1.00
R8224:Gon4l	UTSW	3	88895142	missense	probably damaging	1.00
R8260:Gon4l	UTSW	3	88892630	missense	probably damaging	0.98
R8434:Gon4l	UTSW	3	88854779	missense	probably damaging	1.00
R8732:Gon4l	UTSW	3	88899984	missense	possibly damaging	0.95
R8812:Gon4l	UTSW	3	88895007	missense	possibly damaging	0.86
R9132:Gon4l	UTSW	3	88908177	missense	probably benign	0.29
R9161:Gon4l	UTSW	3	88901648	missense	probably damaging	1.00
R9187:Gon4l	UTSW	3	88879311	missense	probably benign	0.10
R9212:Gon4l	UTSW	3	88896423	missense	probably benign	0.01
R9338:Gon4l	UTSW	3	88901712	missense	probably benign	0.00
R9387:Gon4l	UTSW	3	88894953	missense	probably benign	0.00
R9416:Gon4l	UTSW	3	88896231	missense	probably benign	0.00
Z1177:Gon4l	UTSW	3	88859036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCATTGCAGAGGGTGTAG -3'
(R):5'- TGCTGAAGCTACCTACTGAAATC -3'

Sequencing Primer
(F):5'- GTGTAGTGTGGAGAATTTACAAGC -3'
(R):5'- TGCTAAGCACATGTTCTAACCCTGAG -3'

Posted On

2014-10-30