Incidental Mutation 'R2347:Fut2'
ID246004
Institutional Source Beutler Lab
Gene Symbol Fut2
Ensembl Gene ENSMUSG00000055978
Gene Namefucosyltransferase 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2347 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45648591-45666394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45650328 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 340 (D340G)
Ref Sequence ENSEMBL: ENSMUSP00000063719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]
Predicted Effect probably damaging
Transcript: ENSMUST00000069800
AA Change: D340G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: D340G

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 21 338 2.1e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210213
Predicted Effect probably benign
Transcript: ENSMUST00000210620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211324
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1a C T 8: 93,025,319 V396M probably benign Het
Ddx6 A G 9: 44,607,591 K67E probably benign Het
Gm128 A G 3: 95,240,930 Y18H probably benign Het
Gon4l A G 3: 88,863,517 D502G probably damaging Het
Lman2 T A 13: 55,352,999 N129I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1263 G T 2: 90,015,614 R228L possibly damaging Het
Olfr527 T A 7: 140,336,147 M95K probably damaging Het
Olfr935 A T 9: 38,994,509 *309K probably null Het
Pappa2 C A 1: 158,765,043 C1588F probably damaging Het
Piwil2 T C 14: 70,408,917 D390G probably damaging Het
Rest A G 5: 77,268,593 Y218C probably damaging Het
Other mutations in Fut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02831:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02982:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03071:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03090:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03126:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03146:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03151:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03179:Fut2 APN 7 45650649 missense probably benign 0.02
IGL03212:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03213:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03234:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03271:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03372:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03381:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03385:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03392:Fut2 APN 7 45650769 missense possibly damaging 0.94
PIT4515001:Fut2 UTSW 7 45650466 missense probably damaging 1.00
R0553:Fut2 UTSW 7 45651274 missense probably damaging 1.00
R1895:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R1946:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R3155:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R3156:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R4590:Fut2 UTSW 7 45650946 missense possibly damaging 0.64
R6311:Fut2 UTSW 7 45650380 missense possibly damaging 0.46
R6810:Fut2 UTSW 7 45650505 missense probably damaging 1.00
R6965:Fut2 UTSW 7 45650881 missense probably damaging 1.00
R8135:Fut2 UTSW 7 45651142 missense probably damaging 1.00
X0066:Fut2 UTSW 7 45650374 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCATTGATAATGTCTGAGCTG -3'
(R):5'- AATGGTATTGAGGGCTCACCAG -3'

Sequencing Primer
(F):5'- CTGAGCTGTTAATGAATGTTGGAAC -3'
(R):5'- AAGGACTTCGCGCTCCTCAC -3'
Posted On2014-10-30