Incidental Mutation 'R2347:Olfr527'
ID 246005
Institutional Source Beutler Lab
Gene Symbol Olfr527
Ensembl Gene ENSMUSG00000062782
Gene Name olfactory receptor 527
Synonyms GA_x6K02T2PBJ9-42486061-42486978, MOR251-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R2347 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140334017-140338551 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140336147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 95 (M95K)
Ref Sequence ENSEMBL: ENSMUSP00000149080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172230] [ENSMUST00000214143] [ENSMUST00000214858]
AlphaFold Q7TRT9
Predicted Effect probably damaging
Transcript: ENSMUST00000172230
AA Change: M95K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129414
Gene: ENSMUSG00000062782
AA Change: M95K

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 179 9.1e-8 PFAM
Pfam:7tm_1 39 287 7.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214143
AA Change: M95K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214858
AA Change: M95K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1a C T 8: 93,025,319 V396M probably benign Het
Ddx6 A G 9: 44,607,591 K67E probably benign Het
Fut2 T C 7: 45,650,328 D340G probably damaging Het
Gm128 A G 3: 95,240,930 Y18H probably benign Het
Gon4l A G 3: 88,863,517 D502G probably damaging Het
Lman2 T A 13: 55,352,999 N129I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1263 G T 2: 90,015,614 R228L possibly damaging Het
Olfr935 A T 9: 38,994,509 *309K probably null Het
Pappa2 C A 1: 158,765,043 C1588F probably damaging Het
Piwil2 T C 14: 70,408,917 D390G probably damaging Het
Rest A G 5: 77,268,593 Y218C probably damaging Het
Other mutations in Olfr527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02818:Olfr527 APN 7 140336606 missense possibly damaging 0.90
IGL02885:Olfr527 APN 7 140336159 missense possibly damaging 0.94
R1340:Olfr527 UTSW 7 140336125 missense probably benign 0.10
R1711:Olfr527 UTSW 7 140335999 missense possibly damaging 0.55
R1860:Olfr527 UTSW 7 140336219 missense possibly damaging 0.78
R2042:Olfr527 UTSW 7 140335937 missense probably damaging 1.00
R2072:Olfr527 UTSW 7 140336653 missense possibly damaging 0.85
R2128:Olfr527 UTSW 7 140336429 missense probably damaging 1.00
R2449:Olfr527 UTSW 7 140336432 missense probably benign
R2973:Olfr527 UTSW 7 140336387 missense probably damaging 1.00
R3151:Olfr527 UTSW 7 140336330 missense probably benign 0.01
R4320:Olfr527 UTSW 7 140336306 missense possibly damaging 0.94
R5561:Olfr527 UTSW 7 140336152 nonsense probably null
R5566:Olfr527 UTSW 7 140336067 missense probably damaging 1.00
R5891:Olfr527 UTSW 7 140336600 missense probably benign 0.06
R7227:Olfr527 UTSW 7 140335621 start gained probably benign
R7296:Olfr527 UTSW 7 140336741 missense possibly damaging 0.91
R7568:Olfr527 UTSW 7 140335982 missense probably damaging 1.00
R8000:Olfr527 UTSW 7 140336342 missense possibly damaging 0.61
R8171:Olfr527 UTSW 7 140336230 missense probably damaging 1.00
R8203:Olfr527 UTSW 7 140336026 missense probably benign 0.14
R8351:Olfr527 UTSW 7 140336605 missense probably damaging 1.00
R8451:Olfr527 UTSW 7 140336605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTGCAATCTCAGGAAAC -3'
(R):5'- CTGCAGAATGGTAGACGCAAC -3'

Sequencing Primer
(F):5'- GCTGCAATCTCAGGAAACTTGCTC -3'
(R):5'- TAGACGCAACATCAGGCCTGTG -3'
Posted On 2014-10-30