Incidental Mutation 'R2347:Olfr935'
ID 246008
Institutional Source Beutler Lab
Gene Symbol Olfr935
Ensembl Gene ENSMUSG00000059595
Gene Name olfactory receptor 935
Synonyms GA_x6K02T2PVTD-32691280-32690354, MOR171-11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R2347 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38993971-38999683 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to T at 38994509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Lysine at position 309 (*309K)
Ref Sequence ENSEMBL: ENSMUSP00000149193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080748] [ENSMUST00000214157]
AlphaFold Q8VG16
Predicted Effect probably null
Transcript: ENSMUST00000080748
AA Change: *309K
SMART Domains Protein: ENSMUSP00000079572
Gene: ENSMUSG00000059595
AA Change: *309K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-53 PFAM
Pfam:7tm_1 41 290 1.2e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214157
AA Change: *309K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1a C T 8: 93,025,319 V396M probably benign Het
Ddx6 A G 9: 44,607,591 K67E probably benign Het
Fut2 T C 7: 45,650,328 D340G probably damaging Het
Gm128 A G 3: 95,240,930 Y18H probably benign Het
Gon4l A G 3: 88,863,517 D502G probably damaging Het
Lman2 T A 13: 55,352,999 N129I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1263 G T 2: 90,015,614 R228L possibly damaging Het
Olfr527 T A 7: 140,336,147 M95K probably damaging Het
Pappa2 C A 1: 158,765,043 C1588F probably damaging Het
Piwil2 T C 14: 70,408,917 D390G probably damaging Het
Rest A G 5: 77,268,593 Y218C probably damaging Het
Other mutations in Olfr935
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr935 APN 9 38995100 missense probably benign 0.08
IGL01671:Olfr935 APN 9 38994853 missense probably benign 0.05
IGL02331:Olfr935 APN 9 38995106 missense probably damaging 0.99
IGL03069:Olfr935 APN 9 38995432 start codon destroyed probably null 0.98
IGL03143:Olfr935 APN 9 38995436 utr 5 prime probably benign
R0149:Olfr935 UTSW 9 38994584 missense probably benign 0.05
R0400:Olfr935 UTSW 9 38995198 missense probably damaging 1.00
R1818:Olfr935 UTSW 9 38994606 missense possibly damaging 0.61
R2092:Olfr935 UTSW 9 38995189 missense probably damaging 1.00
R2151:Olfr935 UTSW 9 38994716 missense probably damaging 1.00
R2166:Olfr935 UTSW 9 38995217 nonsense probably null
R4404:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R4406:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R5152:Olfr935 UTSW 9 38995177 missense possibly damaging 0.88
R5467:Olfr935 UTSW 9 38994904 missense probably benign 0.14
R5509:Olfr935 UTSW 9 38994628 missense probably benign 0.03
R5954:Olfr935 UTSW 9 38995415 missense probably damaging 1.00
R6647:Olfr935 UTSW 9 38994914 missense possibly damaging 0.55
R6680:Olfr935 UTSW 9 38994658 missense probably damaging 1.00
R6928:Olfr935 UTSW 9 38994632 missense probably benign 0.03
R7242:Olfr935 UTSW 9 38995141 missense probably benign 0.31
R7271:Olfr935 UTSW 9 38994657 nonsense probably null
R7309:Olfr935 UTSW 9 38995280 missense probably damaging 1.00
R7775:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7778:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7866:Olfr935 UTSW 9 38994731 missense not run
R8280:Olfr935 UTSW 9 38994779 missense probably benign
R8334:Olfr935 UTSW 9 38994593 missense probably benign 0.00
R8841:Olfr935 UTSW 9 38994583 missense possibly damaging 0.95
R9161:Olfr935 UTSW 9 38994520 missense possibly damaging 0.70
R9169:Olfr935 UTSW 9 38995277 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGACCCTGGAATTGAAGACAC -3'
(R):5'- GGGCAGATCTAAAACCTTCAGC -3'

Sequencing Primer
(F):5'- CCCTGGAATTGAAGACACAAGGTG -3'
(R):5'- TGCAGCTCCCACATCTCAG -3'
Posted On 2014-10-30