Incidental Mutation 'R2347:Ddx6'
ID 246009
Institutional Source Beutler Lab
Gene Symbol Ddx6
Ensembl Gene ENSMUSG00000032097
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Synonyms mRCK/P54, HLR2, rck, C430015D01Rik, 1110001P04Rik, p54, E230023J21Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2347 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44604892-44640731 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44607591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 67 (K67E)
Ref Sequence ENSEMBL: ENSMUSP00000149620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170489] [ENSMUST00000217034]
AlphaFold P54823
Predicted Effect probably benign
Transcript: ENSMUST00000170489
AA Change: K67E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128421
Gene: ENSMUSG00000032097
AA Change: K67E

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Blast:DEXDc 42 88 7e-18 BLAST
DEXDc 115 312 3.67e-52 SMART
HELICc 348 429 1.59e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214898
Predicted Effect probably benign
Transcript: ENSMUST00000217034
AA Change: K67E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The protein is an RNA helicase found in P-bodies and stress granules, and functions in translation suppression and mRNA degradation. It is required for microRNA-induced gene silencing. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1a C T 8: 93,025,319 V396M probably benign Het
Fut2 T C 7: 45,650,328 D340G probably damaging Het
Gm128 A G 3: 95,240,930 Y18H probably benign Het
Gon4l A G 3: 88,863,517 D502G probably damaging Het
Lman2 T A 13: 55,352,999 N129I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1263 G T 2: 90,015,614 R228L possibly damaging Het
Olfr527 T A 7: 140,336,147 M95K probably damaging Het
Olfr935 A T 9: 38,994,509 *309K probably null Het
Pappa2 C A 1: 158,765,043 C1588F probably damaging Het
Piwil2 T C 14: 70,408,917 D390G probably damaging Het
Rest A G 5: 77,268,593 Y218C probably damaging Het
Other mutations in Ddx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02561:Ddx6 APN 9 44634168 missense probably damaging 0.96
IGL02880:Ddx6 APN 9 44612897 splice site probably benign
R0278:Ddx6 UTSW 9 44631425 missense probably damaging 1.00
R1330:Ddx6 UTSW 9 44627773 splice site probably benign
R2001:Ddx6 UTSW 9 44607534 missense probably benign
R2002:Ddx6 UTSW 9 44607534 missense probably benign
R2124:Ddx6 UTSW 9 44624519 nonsense probably null
R2177:Ddx6 UTSW 9 44627731 missense probably damaging 1.00
R2863:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R2865:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R4584:Ddx6 UTSW 9 44624487 missense probably damaging 1.00
R4915:Ddx6 UTSW 9 44612873 missense probably damaging 1.00
R5476:Ddx6 UTSW 9 44607456 missense possibly damaging 0.67
R6213:Ddx6 UTSW 9 44628693 missense probably damaging 0.99
R6264:Ddx6 UTSW 9 44628752 missense probably damaging 1.00
R6368:Ddx6 UTSW 9 44635776 missense probably damaging 1.00
R6525:Ddx6 UTSW 9 44623629 missense probably damaging 1.00
R6994:Ddx6 UTSW 9 44628723 missense probably damaging 0.98
R7252:Ddx6 UTSW 9 44623753 splice site probably null
R7463:Ddx6 UTSW 9 44628729 missense probably damaging 1.00
R7706:Ddx6 UTSW 9 44627642 missense probably damaging 1.00
R7752:Ddx6 UTSW 9 44627663 missense probably damaging 1.00
R7784:Ddx6 UTSW 9 44630142 critical splice donor site probably null
RF004:Ddx6 UTSW 9 44624492 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AAGAGACACCTGTGCAGCTAAC -3'
(R):5'- TGCTGGGTCGATTACAATGG -3'

Sequencing Primer
(F):5'- CAGAGAACCCTGTTATCATGGGTC -3'
(R):5'- TGGCAGGTCACACACTACTTG -3'
Posted On 2014-10-30