Mutagenetix > Incidental Mutations

Incidental Mutation 'R2347:Lman2'

246013

Institutional Source

Beutler Lab

Gene Symbol

Lman2

Ensembl Gene

ENSMUSG00000021484

Gene Name

lectin, mannose-binding 2

Synonyms

1300009F09Rik, 1110003H06Rik, VIP36, GP36B

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.256) question?

Stock #

R2347 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55343833-55362783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55352999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 129 (N129I)

Ref Sequence

ENSEMBL: ENSMUSP00000021940 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021940]

AlphaFold

Q9DBH5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021940
AA Change: N129I

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021940
Gene: ENSMUSG00000021484
AA Change: N129I

Domain	Start	End	E-Value	Type
signal peptide	1	46	N/A	INTRINSIC
Pfam:Lectin_leg-like	54	280	6.6e-104	PFAM
transmembrane domain	325	347	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224517

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225066

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane lectin that shuttles between the endoplasmic reticulum, the Golgi apparatus and the plasma membrane. The encoded protein binds high mannose type glycoproteins and may facilitate their sorting, trafficking and quality control. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ces1a	C	T	8: 93,025,319	V396M	probably benign	Het
Ddx6	A	G	9: 44,607,591	K67E	probably benign	Het
Fut2	T	C	7: 45,650,328	D340G	probably damaging	Het
Gm128	A	G	3: 95,240,930	Y18H	probably benign	Het
Gon4l	A	G	3: 88,863,517	D502G	probably damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1263	G	T	2: 90,015,614	R228L	possibly damaging	Het
Olfr527	T	A	7: 140,336,147	M95K	probably damaging	Het
Olfr935	A	T	9: 38,994,509	*309K	probably null	Het
Pappa2	C	A	1: 158,765,043	C1588F	probably damaging	Het
Piwil2	T	C	14: 70,408,917	D390G	probably damaging	Het
Rest	A	G	5: 77,268,593	Y218C	probably damaging	Het

Other mutations in Lman2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Lman2	APN	13	55351242	missense	possibly damaging	0.91
IGL02381:Lman2	APN	13	55351469	missense	possibly damaging	0.77
R0331:Lman2	UTSW	13	55353016	missense	probably damaging	1.00
R1457:Lman2	UTSW	13	55351251	missense	probably benign	0.01
R1482:Lman2	UTSW	13	55351405	missense	possibly damaging	0.92
R2209:Lman2	UTSW	13	55351502	missense	probably damaging	0.99
R6132:Lman2	UTSW	13	55362225	missense	probably benign
R6297:Lman2	UTSW	13	55348431	missense	probably damaging	0.99
R6461:Lman2	UTSW	13	55346915	missense	probably damaging	1.00
R7148:Lman2	UTSW	13	55352949	missense	probably benign	0.04
R7422:Lman2	UTSW	13	55351525	missense	probably damaging	1.00
R7498:Lman2	UTSW	13	55346977	missense	probably damaging	1.00
R7720:Lman2	UTSW	13	55353077	splice site	probably null
R8826:Lman2	UTSW	13	55362555	missense	unknown
R8872:Lman2	UTSW	13	55348384	missense	probably benign	0.02
R9007:Lman2	UTSW	13	55352960	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCAAGACTCTGGTCAGCAG -3'
(R):5'- GAGCCTAGAGACAGCATCTG -3'

Sequencing Primer
(F):5'- AAGACTCTGGTCAGCAGCAGTC -3'
(R):5'- GACCCCTGAACCTTGAAGTGATTG -3'

Posted On

2014-10-30