Incidental Mutation 'R2347:Lman2'
ID 246013
Institutional Source Beutler Lab
Gene Symbol Lman2
Ensembl Gene ENSMUSG00000021484
Gene Name lectin, mannose-binding 2
Synonyms 1300009F09Rik, 1110003H06Rik, VIP36, GP36B
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R2347 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 55343833-55362783 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55352999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 129 (N129I)
Ref Sequence ENSEMBL: ENSMUSP00000021940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021940]
AlphaFold Q9DBH5
Predicted Effect possibly damaging
Transcript: ENSMUST00000021940
AA Change: N129I

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021940
Gene: ENSMUSG00000021484
AA Change: N129I

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
Pfam:Lectin_leg-like 54 280 6.6e-104 PFAM
transmembrane domain 325 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225066
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane lectin that shuttles between the endoplasmic reticulum, the Golgi apparatus and the plasma membrane. The encoded protein binds high mannose type glycoproteins and may facilitate their sorting, trafficking and quality control. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1a C T 8: 93,025,319 V396M probably benign Het
Ddx6 A G 9: 44,607,591 K67E probably benign Het
Fut2 T C 7: 45,650,328 D340G probably damaging Het
Gm128 A G 3: 95,240,930 Y18H probably benign Het
Gon4l A G 3: 88,863,517 D502G probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1263 G T 2: 90,015,614 R228L possibly damaging Het
Olfr527 T A 7: 140,336,147 M95K probably damaging Het
Olfr935 A T 9: 38,994,509 *309K probably null Het
Pappa2 C A 1: 158,765,043 C1588F probably damaging Het
Piwil2 T C 14: 70,408,917 D390G probably damaging Het
Rest A G 5: 77,268,593 Y218C probably damaging Het
Other mutations in Lman2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lman2 APN 13 55351242 missense possibly damaging 0.91
IGL02381:Lman2 APN 13 55351469 missense possibly damaging 0.77
R0331:Lman2 UTSW 13 55353016 missense probably damaging 1.00
R1457:Lman2 UTSW 13 55351251 missense probably benign 0.01
R1482:Lman2 UTSW 13 55351405 missense possibly damaging 0.92
R2209:Lman2 UTSW 13 55351502 missense probably damaging 0.99
R6132:Lman2 UTSW 13 55362225 missense probably benign
R6297:Lman2 UTSW 13 55348431 missense probably damaging 0.99
R6461:Lman2 UTSW 13 55346915 missense probably damaging 1.00
R7148:Lman2 UTSW 13 55352949 missense probably benign 0.04
R7422:Lman2 UTSW 13 55351525 missense probably damaging 1.00
R7498:Lman2 UTSW 13 55346977 missense probably damaging 1.00
R7720:Lman2 UTSW 13 55353077 splice site probably null
R8826:Lman2 UTSW 13 55362555 missense unknown
R8872:Lman2 UTSW 13 55348384 missense probably benign 0.02
R9007:Lman2 UTSW 13 55352960 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAAGACTCTGGTCAGCAG -3'
(R):5'- GAGCCTAGAGACAGCATCTG -3'

Sequencing Primer
(F):5'- AAGACTCTGGTCAGCAGCAGTC -3'
(R):5'- GACCCCTGAACCTTGAAGTGATTG -3'
Posted On 2014-10-30