Incidental Mutation 'R2347:Piwil2'
ID246014
Institutional Source Beutler Lab
Gene Symbol Piwil2
Ensembl Gene ENSMUSG00000033644
Gene Namepiwi-like RNA-mediated gene silencing 2
SynonymsMiwi like, mili
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2347 (G1)
Quality Score127
Status Not validated
Chromosome14
Chromosomal Location70372477-70429383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70408917 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 390 (D390G)
Ref Sequence ENSEMBL: ENSMUSP00000047385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048129] [ENSMUST00000226229]
PDB Structure
Structure of extended Tudor domain TD3 from mouse TDRD1 in complex with MILI peptide containing dimethylarginine 45. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048129
AA Change: D390G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047385
Gene: ENSMUSG00000033644
AA Change: D390G

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
DUF1785 335 386 7.44e-2 SMART
PAZ 386 524 1.92e-62 SMART
Piwi 666 957 2.45e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226229
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL2 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testis weight, azoospermia, and male infertility associated with a complete arrest of spermatogenesis and increased apoptotic cell death during the early prophase of the first meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1a C T 8: 93,025,319 V396M probably benign Het
Ddx6 A G 9: 44,607,591 K67E probably benign Het
Fut2 T C 7: 45,650,328 D340G probably damaging Het
Gm128 A G 3: 95,240,930 Y18H probably benign Het
Gon4l A G 3: 88,863,517 D502G probably damaging Het
Lman2 T A 13: 55,352,999 N129I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1263 G T 2: 90,015,614 R228L possibly damaging Het
Olfr527 T A 7: 140,336,147 M95K probably damaging Het
Olfr935 A T 9: 38,994,509 *309K probably null Het
Pappa2 C A 1: 158,765,043 C1588F probably damaging Het
Rest A G 5: 77,268,593 Y218C probably damaging Het
Other mutations in Piwil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Piwil2 APN 14 70398218 missense probably benign 0.35
IGL02215:Piwil2 APN 14 70391373 missense possibly damaging 0.50
IGL02427:Piwil2 APN 14 70398134 splice site probably benign
IGL02554:Piwil2 APN 14 70391486 splice site probably benign
R0257:Piwil2 UTSW 14 70422631 missense probably benign 0.00
R0566:Piwil2 UTSW 14 70410394 missense probably damaging 0.99
R0800:Piwil2 UTSW 14 70409037 unclassified probably benign
R0828:Piwil2 UTSW 14 70376017 missense probably damaging 1.00
R0862:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0864:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0881:Piwil2 UTSW 14 70408927 missense probably benign 0.34
R1734:Piwil2 UTSW 14 70426505 critical splice donor site probably null
R1997:Piwil2 UTSW 14 70426658 missense possibly damaging 0.90
R2011:Piwil2 UTSW 14 70426634 missense probably damaging 1.00
R2043:Piwil2 UTSW 14 70391470 missense probably benign 0.00
R2998:Piwil2 UTSW 14 70411238 missense probably damaging 1.00
R4402:Piwil2 UTSW 14 70408916 missense probably benign 0.01
R4455:Piwil2 UTSW 14 70390565 missense probably benign 0.02
R4611:Piwil2 UTSW 14 70402197 missense probably benign 0.07
R4763:Piwil2 UTSW 14 70376778 missense probably damaging 1.00
R4869:Piwil2 UTSW 14 70395362 missense probably benign 0.00
R5033:Piwil2 UTSW 14 70421593 missense possibly damaging 0.71
R5207:Piwil2 UTSW 14 70392517 missense probably damaging 1.00
R5395:Piwil2 UTSW 14 70395397 missense probably benign 0.01
R5486:Piwil2 UTSW 14 70401431 missense probably benign 0.01
R5504:Piwil2 UTSW 14 70389899 missense probably benign 0.01
R5629:Piwil2 UTSW 14 70422967 missense probably damaging 1.00
R5967:Piwil2 UTSW 14 70390564 missense probably benign 0.00
R6167:Piwil2 UTSW 14 70422893 critical splice donor site probably null
R6168:Piwil2 UTSW 14 70395351 missense probably benign 0.04
R6517:Piwil2 UTSW 14 70374336 missense probably benign 0.44
R7261:Piwil2 UTSW 14 70374411 missense probably damaging 1.00
R7727:Piwil2 UTSW 14 70394057 missense probably damaging 1.00
R7745:Piwil2 UTSW 14 70394189 missense probably benign
R7833:Piwil2 UTSW 14 70395441 missense probably benign 0.02
R7916:Piwil2 UTSW 14 70395441 missense probably benign 0.02
R8044:Piwil2 UTSW 14 70391438 missense possibly damaging 0.90
R8066:Piwil2 UTSW 14 70420719 missense probably benign 0.00
X0023:Piwil2 UTSW 14 70398199 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGAGTCATCATACCTGGATC -3'
(R):5'- GTAAGTTTGTACTGACACCGATTTG -3'

Sequencing Primer
(F):5'- GGAGTCATCATACCTGGATCCAGTTC -3'
(R):5'- CTTCCTCATGATTATCAAGGAAGGGC -3'
Posted On2014-10-30