Incidental Mutation 'R2348:2810403A07Rik'
ID246023
Institutional Source Beutler Lab
Gene Symbol 2810403A07Rik
Ensembl Gene ENSMUSG00000028060
Gene NameRIKEN cDNA 2810403A07 gene
Synonyms
MMRRC Submission 040330-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R2348 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88685803-88712924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88708876 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 457 (S457P)
Ref Sequence ENSEMBL: ENSMUSP00000142353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029696] [ENSMUST00000198042] [ENSMUST00000198078] [ENSMUST00000199684]
Predicted Effect probably benign
Transcript: ENSMUST00000029696
AA Change: S457P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029696
Gene: ENSMUSG00000028060
AA Change: S457P

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 2e-28 BLAST
PDB:2YQR|A 229 340 6e-76 PDB
Blast:KH 233 319 1e-36 BLAST
SCOP:d1k1ga_ 233 327 4e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 566 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197300
Predicted Effect probably benign
Transcript: ENSMUST00000198042
AA Change: S457P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142773
Gene: ENSMUSG00000028060
AA Change: S457P

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000198078
AA Change: V422A
SMART Domains Protein: ENSMUSP00000142760
Gene: ENSMUSG00000028060
AA Change: V422A

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 5e-29 BLAST
PDB:2YQR|A 229 340 1e-77 PDB
Blast:KH 233 319 3e-37 BLAST
SCOP:d1k1ga_ 233 327 4e-17 SMART
low complexity region 410 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198721
Predicted Effect probably benign
Transcript: ENSMUST00000199684
AA Change: S457P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142353
Gene: ENSMUSG00000028060
AA Change: S457P

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200622
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1 A G 17: 93,202,274 D51G possibly damaging Het
Ano3 A G 2: 110,783,743 I205T possibly damaging Het
Arhgap10 A T 8: 77,450,926 probably benign Het
Asb18 T G 1: 90,014,534 D15A probably damaging Het
Atm C A 9: 53,492,268 S1368I possibly damaging Het
Atp9a A T 2: 168,710,826 probably benign Het
C2cd3 T C 7: 100,413,366 V653A probably damaging Het
Ctc1 T A 11: 69,026,191 S304T probably benign Het
Dennd4c G A 4: 86,811,527 V789I probably benign Het
Dlgap4 C A 2: 156,701,206 D176E possibly damaging Het
Hdac5 T C 11: 102,200,014 T747A probably benign Het
Htr2a A T 14: 74,645,110 N179Y probably damaging Het
Ift52 T C 2: 163,045,257 V393A probably damaging Het
Itch T C 2: 155,209,078 S562P possibly damaging Het
Kiss1r G T 10: 79,921,820 R336L probably benign Het
Klra13-ps A T 6: 130,291,308 noncoding transcript Het
Krt8 T C 15: 101,998,865 D261G probably benign Het
Mycl A T 4: 122,996,952 T144S probably benign Het
Naip5 C T 13: 100,219,738 R1123K probably benign Het
Olfr1484 A T 19: 13,586,189 E295V probably damaging Het
Rasip1 T G 7: 45,629,083 probably null Het
Rc3h1 C A 1: 160,950,860 R452S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Vmn2r88 A T 14: 51,414,004 K258N probably benign Het
Vps37c T C 19: 10,706,300 S29P probably damaging Het
Zfp457 T A 13: 67,293,404 D369V probably benign Het
Other mutations in 2810403A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0085:2810403A07Rik UTSW 3 88711739 missense probably damaging 0.99
R0271:2810403A07Rik UTSW 3 88686329 splice site probably benign
R1160:2810403A07Rik UTSW 3 88708862 missense probably damaging 0.99
R3121:2810403A07Rik UTSW 3 88689292 missense probably damaging 1.00
R3546:2810403A07Rik UTSW 3 88693136 splice site probably benign
R3548:2810403A07Rik UTSW 3 88693136 splice site probably benign
R4688:2810403A07Rik UTSW 3 88686517 missense probably damaging 1.00
R5249:2810403A07Rik UTSW 3 88696725 missense probably damaging 1.00
R5393:2810403A07Rik UTSW 3 88696606 missense probably benign 0.08
R5558:2810403A07Rik UTSW 3 88693096 missense probably damaging 0.98
R5579:2810403A07Rik UTSW 3 88700275 missense probably benign
R5782:2810403A07Rik UTSW 3 88711678 missense probably damaging 0.96
R5809:2810403A07Rik UTSW 3 88708885 missense probably damaging 0.96
R6415:2810403A07Rik UTSW 3 88699972 missense probably benign 0.25
R6566:2810403A07Rik UTSW 3 88711654 missense probably damaging 0.99
R6765:2810403A07Rik UTSW 3 88686429 missense probably damaging 1.00
R6939:2810403A07Rik UTSW 3 88686517 missense probably damaging 1.00
R7248:2810403A07Rik UTSW 3 88693579 missense probably damaging 1.00
R7311:2810403A07Rik UTSW 3 88711695 missense probably damaging 0.96
R7852:2810403A07Rik UTSW 3 88696736 missense probably benign 0.06
R7935:2810403A07Rik UTSW 3 88696736 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTGAAACACGCTCACTGTTG -3'
(R):5'- ACTGGTCAAGTAAACTCACTCTTGC -3'

Sequencing Primer
(F):5'- CTCACTGTTGAGGTTTGTTCTTAG -3'
(R):5'- CCTAACATAACTGGATTTCAGAAGGG -3'
Posted On2014-10-30