Incidental Mutation 'R0284:Bmp2k'
ID24603
Institutional Source Beutler Lab
Gene Symbol Bmp2k
Ensembl Gene ENSMUSG00000034663
Gene NameBMP2 inducible kinase
Synonyms4933417M22Rik, BIKE
MMRRC Submission 038505-MU
Accession Numbers

Genbank: NM_080708; MGI: 2155456

Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R0284 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location96997689-97091867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97068455 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 604 (H604L)
Ref Sequence ENSEMBL: ENSMUSP00000108598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035635] [ENSMUST00000112974]
Predicted Effect unknown
Transcript: ENSMUST00000035635
AA Change: H604L
SMART Domains Protein: ENSMUSP00000037970
Gene: ENSMUSG00000034663
AA Change: H604L

DomainStartEndE-ValueType
low complexity region 12 37 N/A INTRINSIC
Pfam:Pkinase_Tyr 48 309 8.9e-27 PFAM
Pfam:Pkinase 48 311 1.6e-43 PFAM
coiled coil region 455 490 N/A INTRINSIC
low complexity region 511 538 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 838 852 N/A INTRINSIC
Pfam:BMP2K_C 873 1138 7.9e-94 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112974
AA Change: H604L
SMART Domains Protein: ENSMUSP00000108598
Gene: ENSMUSG00000034663
AA Change: H604L

DomainStartEndE-ValueType
low complexity region 12 37 N/A INTRINSIC
Pfam:Pkinase_Tyr 48 310 5.5e-28 PFAM
Pfam:Pkinase 48 313 5.2e-43 PFAM
Pfam:Kinase-like 128 302 1.2e-7 PFAM
coiled coil region 455 490 N/A INTRINSIC
low complexity region 511 538 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.4%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human homolog of mouse BMP-2-inducible kinase. Bone morphogenic proteins (BMPs) play a key role in skeletal development and patterning. Expression of the mouse gene is increased during BMP-2 induced differentiation and the gene product is a putative serine/threonine protein kinase containing a nuclear localization signal. Therefore, the protein encoded by this human homolog is thought to be a protein kinase with a putative regulatory role in attenuating the program of osteoblast differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T G 4: 41,507,538 E150A probably damaging Het
Akap2 T C 4: 57,855,207 F220L probably damaging Het
Alkbh6 A G 7: 30,313,988 T161A probably benign Het
Alox12e A G 11: 70,320,899 probably benign Het
Ap1g2 A G 14: 55,101,692 probably benign Het
Arid2 A T 15: 96,378,967 probably benign Het
Cacna1a A T 8: 84,612,285 M1705L probably damaging Het
Cacna1d A T 14: 30,072,105 D1526E probably damaging Het
Ccdc171 A G 4: 83,549,738 R107G possibly damaging Het
Cklf T C 8: 104,261,575 probably benign Het
Crabp1 A G 9: 54,764,926 K9E probably benign Het
Cspg4 A G 9: 56,886,139 D386G probably damaging Het
Cyp3a41b G A 5: 145,578,204 probably benign Het
Dsg1a T A 18: 20,331,627 V393E probably damaging Het
Ednrb C T 14: 103,820,013 G371D probably damaging Het
Efcab5 T C 11: 77,103,527 probably benign Het
Exoc2 A T 13: 30,877,625 probably benign Het
Fbn2 G A 18: 58,050,290 probably benign Het
Foxo6 T C 4: 120,269,002 S199G probably benign Het
Fpr1 T A 17: 17,877,356 I124F probably damaging Het
Gk5 A T 9: 96,181,770 probably null Het
Gys1 A T 7: 45,436,719 probably benign Het
Igfbp1 T C 11: 7,198,103 S49P probably damaging Het
Incenp A T 19: 9,893,993 S91T unknown Het
Itpkc G A 7: 27,214,543 R498* probably null Het
Kat6a A G 8: 22,939,803 T1725A unknown Het
Kiz T A 2: 146,863,810 C97S probably benign Het
Kri1 A G 9: 21,276,552 probably benign Het
Lipn A G 19: 34,080,706 S276G possibly damaging Het
Llgl1 A G 11: 60,712,141 T881A probably damaging Het
Man1a2 T C 3: 100,684,786 H26R probably damaging Het
Map3k5 T A 10: 20,000,613 F173I probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 A G 12: 57,457,069 Q341R probably damaging Het
Mllt6 G T 11: 97,678,605 A928S probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nipsnap3a C T 4: 52,997,178 T150I probably benign Het
Nsl1 A G 1: 191,065,230 E97G probably damaging Het
Olfr1278 T C 2: 111,292,586 V106A probably benign Het
Olfr251 G A 9: 38,378,584 M234I probably benign Het
Olfr736 G A 14: 50,392,995 V80M probably damaging Het
Olfr830 A T 9: 18,875,552 Y72F probably benign Het
Pdcd6ip A G 9: 113,662,504 L552S probably damaging Het
Plekhf2 T C 4: 10,990,595 probably benign Het
Prdm1 T C 10: 44,456,626 E96G probably damaging Het
Prpf40a T A 2: 53,150,647 E608D probably damaging Het
Prpf40b A T 15: 99,316,393 probably benign Het
Rag2 T C 2: 101,630,119 V258A probably damaging Het
S100a5 A G 3: 90,611,574 I68V probably benign Het
Serpinb8 G A 1: 107,602,918 probably null Het
Slc24a4 T C 12: 102,260,481 V492A probably damaging Het
Spag6l T A 16: 16,780,766 Q287L probably damaging Het
Synpo2 C T 3: 123,079,734 W211* probably null Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trerf1 A G 17: 47,319,545 noncoding transcript Het
Ttn G C 2: 76,846,704 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps13d A T 4: 145,144,802 M1900K probably benign Het
Vps41 A T 13: 18,853,440 D691V probably damaging Het
Zfp518b T C 5: 38,671,740 Y974C probably damaging Het
Zscan29 A T 2: 121,166,733 probably benign Het
Other mutations in Bmp2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Bmp2k APN 5 97063548 splice site probably null
IGL01408:Bmp2k APN 5 97086964 nonsense probably null
IGL02146:Bmp2k APN 5 97064830 missense unknown
IGL02232:Bmp2k APN 5 97031250 splice site probably benign
3-1:Bmp2k UTSW 5 97053120 missense possibly damaging 0.68
R0277:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0323:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0384:Bmp2k UTSW 5 97031125 splice site probably benign
R0726:Bmp2k UTSW 5 97087494 utr 3 prime probably benign
R1479:Bmp2k UTSW 5 97053200 missense probably benign 0.16
R1686:Bmp2k UTSW 5 97063533 missense unknown
R1826:Bmp2k UTSW 5 97061402 splice site probably benign
R3842:Bmp2k UTSW 5 97087151 utr 3 prime probably benign
R3919:Bmp2k UTSW 5 97074740 missense unknown
R4649:Bmp2k UTSW 5 97053111 missense possibly damaging 0.95
R4954:Bmp2k UTSW 5 97086764 unclassified probably benign
R4975:Bmp2k UTSW 5 97087085 utr 3 prime probably benign
R5001:Bmp2k UTSW 5 97053142 missense probably damaging 1.00
R5122:Bmp2k UTSW 5 97087015 utr 3 prime probably benign
R5260:Bmp2k UTSW 5 97087351 utr 3 prime probably benign
R5516:Bmp2k UTSW 5 97087453 utr 3 prime probably benign
R5762:Bmp2k UTSW 5 97087191 frame shift probably null
R5807:Bmp2k UTSW 5 97063494 missense unknown
R5835:Bmp2k UTSW 5 97056982 missense possibly damaging 0.95
R5928:Bmp2k UTSW 5 97087736 utr 3 prime probably benign
R6012:Bmp2k UTSW 5 97063608 intron probably null
R6546:Bmp2k UTSW 5 97088078 missense probably benign 0.32
R6664:Bmp2k UTSW 5 97088130 missense probably benign 0.03
R6962:Bmp2k UTSW 5 97031238 nonsense probably null
R7081:Bmp2k UTSW 5 97064961 missense unknown
R7267:Bmp2k UTSW 5 97068434 missense unknown
R7473:Bmp2k UTSW 5 97057012 missense probably benign 0.40
R7498:Bmp2k UTSW 5 97088119 missense probably benign 0.03
R7659:Bmp2k UTSW 5 97074719 missense unknown
X0026:Bmp2k UTSW 5 97038533 missense probably damaging 1.00
Z1177:Bmp2k UTSW 5 97053156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGAGCACACTAGCGTGCAGTTAC -3'
(R):5'- GACACCACCTCTAACAGTCTTTGGC -3'

Sequencing Primer
(F):5'- gcataccaggcaagcattttatc -3'
(R):5'- AACAGTCTTTGGCCTTGCTC -3'
Posted On2013-04-16