Incidental Mutation 'R2348:Olfr1484'
ID246044
Institutional Source Beutler Lab
Gene Symbol Olfr1484
Ensembl Gene ENSMUSG00000096289
Gene Nameolfactory receptor 1484
SynonymsMOR202-37, GA_x6K02T2RE5P-3917859-3918806
MMRRC Submission 040330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2348 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13583511-13588832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13586189 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 295 (E295V)
Ref Sequence ENSEMBL: ENSMUSP00000150779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074180] [ENSMUST00000207093] [ENSMUST00000208104] [ENSMUST00000215567] [ENSMUST00000216014] [ENSMUST00000216369] [ENSMUST00000217451]
Predicted Effect probably damaging
Transcript: ENSMUST00000074180
AA Change: E295V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073811
Gene: ENSMUSG00000096289
AA Change: E295V

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 7.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.1e-5 PFAM
Pfam:7tm_1 40 289 3.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207093
AA Change: E295V
Predicted Effect probably damaging
Transcript: ENSMUST00000208104
AA Change: E252V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208420
Predicted Effect probably damaging
Transcript: ENSMUST00000215567
AA Change: E295V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216014
AA Change: E295V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216369
AA Change: E252V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217451
AA Change: E295V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,708,876 S457P probably benign Het
Adcyap1 A G 17: 93,202,274 D51G possibly damaging Het
Ano3 A G 2: 110,783,743 I205T possibly damaging Het
Arhgap10 A T 8: 77,450,926 probably benign Het
Asb18 T G 1: 90,014,534 D15A probably damaging Het
Atm C A 9: 53,492,268 S1368I possibly damaging Het
Atp9a A T 2: 168,710,826 probably benign Het
C2cd3 T C 7: 100,413,366 V653A probably damaging Het
Ctc1 T A 11: 69,026,191 S304T probably benign Het
Dennd4c G A 4: 86,811,527 V789I probably benign Het
Dlgap4 C A 2: 156,701,206 D176E possibly damaging Het
Hdac5 T C 11: 102,200,014 T747A probably benign Het
Htr2a A T 14: 74,645,110 N179Y probably damaging Het
Ift52 T C 2: 163,045,257 V393A probably damaging Het
Itch T C 2: 155,209,078 S562P possibly damaging Het
Kiss1r G T 10: 79,921,820 R336L probably benign Het
Klra13-ps A T 6: 130,291,308 noncoding transcript Het
Krt8 T C 15: 101,998,865 D261G probably benign Het
Mycl A T 4: 122,996,952 T144S probably benign Het
Naip5 C T 13: 100,219,738 R1123K probably benign Het
Rasip1 T G 7: 45,629,083 probably null Het
Rc3h1 C A 1: 160,950,860 R452S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Vmn2r88 A T 14: 51,414,004 K258N probably benign Het
Vps37c T C 19: 10,706,300 S29P probably damaging Het
Zfp457 T A 13: 67,293,404 D369V probably benign Het
Other mutations in Olfr1484
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Olfr1484 APN 19 13586104 missense probably benign 0.05
IGL02104:Olfr1484 APN 19 13585604 missense probably damaging 0.99
IGL02502:Olfr1484 APN 19 13585748 missense probably damaging 1.00
IGL03339:Olfr1484 APN 19 13586075 missense probably damaging 0.99
IGL03391:Olfr1484 APN 19 13586119 missense probably benign
R0008:Olfr1484 UTSW 19 13585876 missense probably benign 0.01
R0607:Olfr1484 UTSW 19 13586170 missense probably damaging 1.00
R0892:Olfr1484 UTSW 19 13585517 missense probably damaging 1.00
R1170:Olfr1484 UTSW 19 13586213 missense probably benign 0.00
R1605:Olfr1484 UTSW 19 13585630 missense probably benign 0.00
R1619:Olfr1484 UTSW 19 13585614 missense probably benign 0.03
R1793:Olfr1484 UTSW 19 13585415 missense probably benign 0.42
R2073:Olfr1484 UTSW 19 13585601 missense probably damaging 1.00
R5025:Olfr1484 UTSW 19 13585522 missense probably benign 0.03
R5383:Olfr1484 UTSW 19 13586075 missense probably damaging 0.99
R5771:Olfr1484 UTSW 19 13585508 missense probably damaging 0.98
R6002:Olfr1484 UTSW 19 13585417 start gained probably benign
R6992:Olfr1484 UTSW 19 13585447 missense possibly damaging 0.57
R7404:Olfr1484 UTSW 19 13585388 missense possibly damaging 0.88
R8358:Olfr1484 UTSW 19 13585400 missense probably damaging 0.97
RF002:Olfr1484 UTSW 19 13586051 missense probably damaging 1.00
X0019:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0019:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0040:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0040:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0067:Olfr1484 UTSW 19 13586072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCCATTTCCACCTGTGC -3'
(R):5'- ACATGAAGTGTGGTGCAGTG -3'

Sequencing Primer
(F):5'- GTGCATCCCACCTTACCACTG -3'
(R):5'- GGGTATTCAACTATCTGGGATTACAG -3'
Posted On2014-10-30