Incidental Mutation 'R2350:Dennd2c'
ID246050
Institutional Source Beutler Lab
Gene Symbol Dennd2c
Ensembl Gene ENSMUSG00000007379
Gene NameDENN/MADD domain containing 2C
Synonyms
MMRRC Submission 040332-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2350 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103102604-103169769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103132001 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 155 (D155G)
Ref Sequence ENSEMBL: ENSMUSP00000134008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172288] [ENSMUST00000173206]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166143
Predicted Effect probably benign
Transcript: ENSMUST00000172288
AA Change: D155G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127187
Gene: ENSMUSG00000007379
AA Change: D155G

DomainStartEndE-ValueType
uDENN 481 571 1.01e-25 SMART
DENN 578 762 3.36e-77 SMART
dDENN 806 873 1.15e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173206
AA Change: D155G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134008
Gene: ENSMUSG00000007379
AA Change: D155G

DomainStartEndE-ValueType
uDENN 424 514 1.01e-25 SMART
DENN 521 705 3.36e-77 SMART
dDENN 749 816 1.15e-20 SMART
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,678,088 probably benign Het
Adam12 T C 7: 133,919,524 T312A probably damaging Het
Adamts20 C T 15: 94,283,916 C1632Y probably damaging Het
Ago2 T C 15: 73,119,461 M543V probably benign Het
Alpk3 T C 7: 81,094,970 L1271P probably damaging Het
Arpin T A 7: 79,931,805 K56* probably null Het
Ccdc138 G T 10: 58,561,893 probably benign Het
Ccdc63 A T 5: 122,122,885 M192K probably benign Het
Cldn12 A T 5: 5,507,845 V194D possibly damaging Het
Cntnap5b T C 1: 100,379,126 L485P probably damaging Het
Cpne7 A G 8: 123,124,469 D165G probably damaging Het
Cyp2j6 A T 4: 96,529,408 M326K probably damaging Het
D630003M21Rik T A 2: 158,201,011 T870S probably damaging Het
Dnah3 A T 7: 120,045,788 probably null Het
Dqx1 T A 6: 83,059,087 C133* probably null Het
Fam234b T A 6: 135,231,724 V545E probably damaging Het
Flcn T C 11: 59,792,659 H564R probably damaging Het
Gsdmc4 T A 15: 63,893,165 H348L probably benign Het
Gucy2c G T 6: 136,763,074 P252T probably damaging Het
Insl6 T A 19: 29,325,245 E24V possibly damaging Het
Irx1 T A 13: 71,960,048 T172S probably damaging Het
Mocos C T 18: 24,666,656 probably benign Het
Myom2 T C 8: 15,108,835 V837A probably benign Het
Nfatc2ip T C 7: 126,395,998 N126S probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Npepl1 T C 2: 174,111,773 S166P probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr867 G T 9: 20,055,088 A125D probably damaging Het
Otop2 T G 11: 115,326,850 C171G probably damaging Het
Parpbp C A 10: 88,133,088 probably benign Het
Pcdhb20 T A 18: 37,504,510 S30T probably benign Het
Phkg1 A T 5: 129,864,532 V359E probably damaging Het
Ppp2cb A G 8: 33,611,827 D131G probably null Het
Scn9a A G 2: 66,504,968 Y1226H probably damaging Het
Unc5b A G 10: 60,778,200 F290S probably benign Het
Vmn1r71 A G 7: 10,747,919 F215L probably benign Het
Vmn2r101 T C 17: 19,589,783 V277A probably benign Het
Vmn2r6 T C 3: 64,556,352 S354G probably benign Het
Zfp292 A T 4: 34,811,281 S588T probably damaging Het
Other mutations in Dennd2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Dennd2c APN 3 103156908 missense probably damaging 1.00
IGL01791:Dennd2c APN 3 103166425 missense probably benign 0.19
IGL02100:Dennd2c APN 3 103153675 missense probably damaging 0.98
IGL02119:Dennd2c APN 3 103137243 missense probably damaging 0.99
IGL02395:Dennd2c APN 3 103157765 missense probably benign 0.00
IGL02631:Dennd2c APN 3 103156071 missense possibly damaging 0.56
IGL02895:Dennd2c APN 3 103137203 missense possibly damaging 0.76
R1749:Dennd2c UTSW 3 103132036 missense possibly damaging 0.92
R1931:Dennd2c UTSW 3 103133252 missense probably benign 0.32
R1964:Dennd2c UTSW 3 103166491 missense probably damaging 1.00
R1972:Dennd2c UTSW 3 103131698 missense probably benign 0.01
R1973:Dennd2c UTSW 3 103131698 missense probably benign 0.01
R2025:Dennd2c UTSW 3 103131689 missense possibly damaging 0.71
R2373:Dennd2c UTSW 3 103156842 missense probably damaging 0.99
R4555:Dennd2c UTSW 3 103131886 missense probably benign 0.00
R4916:Dennd2c UTSW 3 103131824 missense probably benign 0.00
R5560:Dennd2c UTSW 3 103161555 missense probably damaging 1.00
R6291:Dennd2c UTSW 3 103131609 nonsense probably null
R6395:Dennd2c UTSW 3 103149224 critical splice donor site probably null
R6567:Dennd2c UTSW 3 103132019 missense probably benign 0.02
R6681:Dennd2c UTSW 3 103131661 missense probably benign 0.01
R7106:Dennd2c UTSW 3 103131577 missense possibly damaging 0.82
R7162:Dennd2c UTSW 3 103156107 missense probably damaging 1.00
R7514:Dennd2c UTSW 3 103163062 missense probably benign 0.00
R7591:Dennd2c UTSW 3 103133345 missense possibly damaging 0.51
R7698:Dennd2c UTSW 3 103165043 missense possibly damaging 0.65
R8069:Dennd2c UTSW 3 103165130 missense probably damaging 1.00
R8086:Dennd2c UTSW 3 103133345 missense possibly damaging 0.51
R8247:Dennd2c UTSW 3 103152321 missense probably damaging 0.99
R8347:Dennd2c UTSW 3 103157709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGGATGTCAAAAGCCGAGATC -3'
(R):5'- ATACCTGAATGTCCTACGGGG -3'

Sequencing Primer
(F):5'- TGTCAAAAGCCGAGATCAAAGTG -3'
(R):5'- AATGTCCTACGGGGTTTGGGTAAAG -3'
Posted On2014-10-30