Incidental Mutation 'R2350:Ccdc63'
ID246054
Institutional Source Beutler Lab
Gene Symbol Ccdc63
Ensembl Gene ENSMUSG00000043036
Gene Namecoiled-coil domain containing 63
Synonyms4921511C16Rik
MMRRC Submission 040332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2350 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122108040-122140823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122122885 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 192 (M192K)
Ref Sequence ENSEMBL: ENSMUSP00000050582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058960] [ENSMUST00000128101] [ENSMUST00000152389]
Predicted Effect probably benign
Transcript: ENSMUST00000058960
AA Change: M192K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050582
Gene: ENSMUSG00000043036
AA Change: M192K

DomainStartEndE-ValueType
coiled coil region 140 158 N/A INTRINSIC
coiled coil region 209 285 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
coiled coil region 393 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128101
Predicted Effect probably benign
Transcript: ENSMUST00000152389
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,678,088 probably benign Het
Adam12 T C 7: 133,919,524 T312A probably damaging Het
Adamts20 C T 15: 94,283,916 C1632Y probably damaging Het
Ago2 T C 15: 73,119,461 M543V probably benign Het
Alpk3 T C 7: 81,094,970 L1271P probably damaging Het
Arpin T A 7: 79,931,805 K56* probably null Het
Ccdc138 G T 10: 58,561,893 probably benign Het
Cldn12 A T 5: 5,507,845 V194D possibly damaging Het
Cntnap5b T C 1: 100,379,126 L485P probably damaging Het
Cpne7 A G 8: 123,124,469 D165G probably damaging Het
Cyp2j6 A T 4: 96,529,408 M326K probably damaging Het
D630003M21Rik T A 2: 158,201,011 T870S probably damaging Het
Dennd2c A G 3: 103,132,001 D155G probably benign Het
Dnah3 A T 7: 120,045,788 probably null Het
Dqx1 T A 6: 83,059,087 C133* probably null Het
Fam234b T A 6: 135,231,724 V545E probably damaging Het
Flcn T C 11: 59,792,659 H564R probably damaging Het
Gsdmc4 T A 15: 63,893,165 H348L probably benign Het
Gucy2c G T 6: 136,763,074 P252T probably damaging Het
Insl6 T A 19: 29,325,245 E24V possibly damaging Het
Irx1 T A 13: 71,960,048 T172S probably damaging Het
Mocos C T 18: 24,666,656 probably benign Het
Myom2 T C 8: 15,108,835 V837A probably benign Het
Nfatc2ip T C 7: 126,395,998 N126S probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Npepl1 T C 2: 174,111,773 S166P probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr867 G T 9: 20,055,088 A125D probably damaging Het
Otop2 T G 11: 115,326,850 C171G probably damaging Het
Parpbp C A 10: 88,133,088 probably benign Het
Pcdhb20 T A 18: 37,504,510 S30T probably benign Het
Phkg1 A T 5: 129,864,532 V359E probably damaging Het
Ppp2cb A G 8: 33,611,827 D131G probably null Het
Scn9a A G 2: 66,504,968 Y1226H probably damaging Het
Unc5b A G 10: 60,778,200 F290S probably benign Het
Vmn1r71 A G 7: 10,747,919 F215L probably benign Het
Vmn2r101 T C 17: 19,589,783 V277A probably benign Het
Vmn2r6 T C 3: 64,556,352 S354G probably benign Het
Zfp292 A T 4: 34,811,281 S588T probably damaging Het
Other mutations in Ccdc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Ccdc63 APN 5 122124919 splice site probably benign
IGL01660:Ccdc63 APN 5 122110964 missense possibly damaging 0.81
IGL01773:Ccdc63 APN 5 122113145 missense possibly damaging 0.93
IGL02341:Ccdc63 APN 5 122113198 missense probably benign 0.00
IGL03030:Ccdc63 APN 5 122122813 missense probably benign 0.00
IGL02991:Ccdc63 UTSW 5 122108212 missense probably benign 0.10
R0267:Ccdc63 UTSW 5 122117044 splice site probably benign
R0961:Ccdc63 UTSW 5 122110946 missense possibly damaging 0.75
R1333:Ccdc63 UTSW 5 122108161 missense probably benign 0.04
R1802:Ccdc63 UTSW 5 122129877 missense probably damaging 1.00
R1999:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R2048:Ccdc63 UTSW 5 122130287 critical splice donor site probably null
R2150:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R4049:Ccdc63 UTSW 5 122122750 missense probably damaging 0.99
R5072:Ccdc63 UTSW 5 122121055 missense probably benign 0.28
R5847:Ccdc63 UTSW 5 122116845 missense possibly damaging 0.78
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6249:Ccdc63 UTSW 5 122124999 missense probably benign 0.17
R6782:Ccdc63 UTSW 5 122111014 nonsense probably null
R7073:Ccdc63 UTSW 5 122111010 missense probably benign 0.00
R7250:Ccdc63 UTSW 5 122122843 missense probably damaging 1.00
R7448:Ccdc63 UTSW 5 122108182 missense probably benign 0.00
R7584:Ccdc63 UTSW 5 122113204 missense possibly damaging 0.73
R7773:Ccdc63 UTSW 5 122109272 missense probably damaging 1.00
R7856:Ccdc63 UTSW 5 122129943 missense probably benign 0.00
R7939:Ccdc63 UTSW 5 122129943 missense probably benign 0.00
R8114:Ccdc63 UTSW 5 122113181 missense possibly damaging 0.87
X0028:Ccdc63 UTSW 5 122109175 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCTGCTATGACTTATGGCC -3'
(R):5'- AGGAGACACATCATGACAGC -3'

Sequencing Primer
(F):5'- TATGACTTATGGCCCAAGCAGTC -3'
(R):5'- ATGACAGCAGATCCGCCCTG -3'
Posted On2014-10-30