Incidental Mutation 'R2350:Arpin'
ID246061
Institutional Source Beutler Lab
Gene Symbol Arpin
Ensembl Gene ENSMUSG00000039043
Gene Nameactin-related protein 2/3 complex inhibitor
Synonyms2610034B18Rik
MMRRC Submission 040332-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2350 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79925361-79935359 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 79931805 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 56 (K56*)
Ref Sequence ENSEMBL: ENSMUSP00000049440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048731]
Predicted Effect probably null
Transcript: ENSMUST00000048731
AA Change: K56*
SMART Domains Protein: ENSMUSP00000049440
Gene: ENSMUSG00000039043
AA Change: K56*

DomainStartEndE-ValueType
Pfam:UPF0552 1 224 4e-110 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,678,088 probably benign Het
Adam12 T C 7: 133,919,524 T312A probably damaging Het
Adamts20 C T 15: 94,283,916 C1632Y probably damaging Het
Ago2 T C 15: 73,119,461 M543V probably benign Het
Alpk3 T C 7: 81,094,970 L1271P probably damaging Het
Ccdc138 G T 10: 58,561,893 probably benign Het
Ccdc63 A T 5: 122,122,885 M192K probably benign Het
Cldn12 A T 5: 5,507,845 V194D possibly damaging Het
Cntnap5b T C 1: 100,379,126 L485P probably damaging Het
Cpne7 A G 8: 123,124,469 D165G probably damaging Het
Cyp2j6 A T 4: 96,529,408 M326K probably damaging Het
D630003M21Rik T A 2: 158,201,011 T870S probably damaging Het
Dennd2c A G 3: 103,132,001 D155G probably benign Het
Dnah3 A T 7: 120,045,788 probably null Het
Dqx1 T A 6: 83,059,087 C133* probably null Het
Fam234b T A 6: 135,231,724 V545E probably damaging Het
Flcn T C 11: 59,792,659 H564R probably damaging Het
Gsdmc4 T A 15: 63,893,165 H348L probably benign Het
Gucy2c G T 6: 136,763,074 P252T probably damaging Het
Insl6 T A 19: 29,325,245 E24V possibly damaging Het
Irx1 T A 13: 71,960,048 T172S probably damaging Het
Mocos C T 18: 24,666,656 probably benign Het
Myom2 T C 8: 15,108,835 V837A probably benign Het
Nfatc2ip T C 7: 126,395,998 N126S probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Npepl1 T C 2: 174,111,773 S166P probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr867 G T 9: 20,055,088 A125D probably damaging Het
Otop2 T G 11: 115,326,850 C171G probably damaging Het
Parpbp C A 10: 88,133,088 probably benign Het
Pcdhb20 T A 18: 37,504,510 S30T probably benign Het
Phkg1 A T 5: 129,864,532 V359E probably damaging Het
Ppp2cb A G 8: 33,611,827 D131G probably null Het
Scn9a A G 2: 66,504,968 Y1226H probably damaging Het
Unc5b A G 10: 60,778,200 F290S probably benign Het
Vmn1r71 A G 7: 10,747,919 F215L probably benign Het
Vmn2r101 T C 17: 19,589,783 V277A probably benign Het
Vmn2r6 T C 3: 64,556,352 S354G probably benign Het
Zfp292 A T 4: 34,811,281 S588T probably damaging Het
Other mutations in Arpin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Arpin APN 7 79927675 missense probably benign 0.00
IGL01393:Arpin APN 7 79931840 missense possibly damaging 0.51
IGL02127:Arpin APN 7 79928193 missense probably benign 0.01
IGL02553:Arpin APN 7 79927647 missense possibly damaging 0.71
R3821:Arpin UTSW 7 79929660 missense probably damaging 1.00
R3924:Arpin UTSW 7 79929687 missense probably benign 0.02
R5287:Arpin UTSW 7 79928249 missense probably damaging 1.00
R6353:Arpin UTSW 7 79935345 start gained probably benign
R7871:Arpin UTSW 7 79927715 missense probably damaging 1.00
R8211:Arpin UTSW 7 79935244 start codon destroyed probably damaging 1.00
R8350:Arpin UTSW 7 79931867 missense possibly damaging 0.96
R8367:Arpin UTSW 7 79929638 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCAAGAACCATGTAGTCCCTC -3'
(R):5'- TTCCAGGCCTTCTCAGAGAC -3'

Sequencing Primer
(F):5'- AAGAACCATGTAGTCCCTCTCATCTG -3'
(R):5'- CCTTCTCAGAGACAGGTGACAAG -3'
Posted On2014-10-30