Incidental Mutation 'R2350:Alpk3'
ID 246062
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Name alpha-kinase 3
Synonyms Midori
MMRRC Submission 040332-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock # R2350 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 81057600-81105612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81094970 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1271 (L1271P)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107348
AA Change: L1271P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: L1271P

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151115
Meta Mutation Damage Score 0.9044 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,678,088 probably benign Het
Adam12 T C 7: 133,919,524 T312A probably damaging Het
Adamts20 C T 15: 94,283,916 C1632Y probably damaging Het
Ago2 T C 15: 73,119,461 M543V probably benign Het
Arpin T A 7: 79,931,805 K56* probably null Het
Ccdc138 G T 10: 58,561,893 probably benign Het
Ccdc63 A T 5: 122,122,885 M192K probably benign Het
Cldn12 A T 5: 5,507,845 V194D possibly damaging Het
Cntnap5b T C 1: 100,379,126 L485P probably damaging Het
Cpne7 A G 8: 123,124,469 D165G probably damaging Het
Cyp2j6 A T 4: 96,529,408 M326K probably damaging Het
D630003M21Rik T A 2: 158,201,011 T870S probably damaging Het
Dennd2c A G 3: 103,132,001 D155G probably benign Het
Dnah3 A T 7: 120,045,788 probably null Het
Dqx1 T A 6: 83,059,087 C133* probably null Het
Fam234b T A 6: 135,231,724 V545E probably damaging Het
Flcn T C 11: 59,792,659 H564R probably damaging Het
Gsdmc4 T A 15: 63,893,165 H348L probably benign Het
Gucy2c G T 6: 136,763,074 P252T probably damaging Het
Insl6 T A 19: 29,325,245 E24V possibly damaging Het
Irx1 T A 13: 71,960,048 T172S probably damaging Het
Mocos C T 18: 24,666,656 probably benign Het
Myom2 T C 8: 15,108,835 V837A probably benign Het
Nfatc2ip T C 7: 126,395,998 N126S probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Npepl1 T C 2: 174,111,773 S166P probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr867 G T 9: 20,055,088 A125D probably damaging Het
Otop2 T G 11: 115,326,850 C171G probably damaging Het
Parpbp C A 10: 88,133,088 probably benign Het
Pcdhb20 T A 18: 37,504,510 S30T probably benign Het
Phkg1 A T 5: 129,864,532 V359E probably damaging Het
Ppp2cb A G 8: 33,611,827 D131G probably null Het
Scn9a A G 2: 66,504,968 Y1226H probably damaging Het
Unc5b A G 10: 60,778,200 F290S probably benign Het
Vmn1r71 A G 7: 10,747,919 F215L probably benign Het
Vmn2r101 T C 17: 19,589,783 V277A probably benign Het
Vmn2r6 T C 3: 64,556,352 S354G probably benign Het
Zfp292 A T 4: 34,811,281 S588T probably damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2173:Alpk3 UTSW 7 81076900 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2417:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2885:Alpk3 UTSW 7 81100192 missense probably damaging 1.00
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6066:Alpk3 UTSW 7 81076950 missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
R7230:Alpk3 UTSW 7 81093294 missense probably damaging 1.00
R7266:Alpk3 UTSW 7 81092580 missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 81078454 missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 81076912 missense probably benign 0.29
R7411:Alpk3 UTSW 7 81092852 missense probably benign 0.11
R7454:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R7468:Alpk3 UTSW 7 81100998 nonsense probably null
R7940:Alpk3 UTSW 7 81093945 missense probably damaging 1.00
R8157:Alpk3 UTSW 7 81093722 missense probably benign 0.00
R8246:Alpk3 UTSW 7 81092776 missense probably benign 0.00
R8357:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8444:Alpk3 UTSW 7 81057720 missense probably benign 0.08
R8457:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8775:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8775-TAIL:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8794:Alpk3 UTSW 7 81057655 missense unknown
R8982:Alpk3 UTSW 7 81099002 missense probably damaging 1.00
R9259:Alpk3 UTSW 7 81093554 missense probably damaging 1.00
RF034:Alpk3 UTSW 7 81092414 small deletion probably benign
RF057:Alpk3 UTSW 7 81092417 frame shift probably null
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Z1176:Alpk3 UTSW 7 81078626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTTCCCTAAGGATACCC -3'
(R):5'- TTCTCGTGAGGGTCATCACC -3'

Sequencing Primer
(F):5'- TGTTCCCTAAGGATACCCAAGGATG -3'
(R):5'- AGACTCACTCACTGGGACTAGTG -3'
Posted On 2014-10-30