Incidental Mutation 'R2350:Ppp2cb'
ID246067
Institutional Source Beutler Lab
Gene Symbol Ppp2cb
Ensembl Gene ENSMUSG00000009630
Gene Nameprotein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
SynonymsPP2Ac, D8Ertd766e
MMRRC Submission 040332-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2350 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location33599625-33619441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33611827 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 131 (D131G)
Ref Sequence ENSEMBL: ENSMUSP00000009774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009774]
Predicted Effect probably null
Transcript: ENSMUST00000009774
AA Change: D131G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009774
Gene: ENSMUSG00000009630
AA Change: D131G

DomainStartEndE-ValueType
PP2Ac 23 293 2.48e-156 SMART
Meta Mutation Damage Score 0.6843 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the phosphatase 2A catalytic subunit. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. This gene encodes a beta isoform of the catalytic subunit. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,678,088 probably benign Het
Adam12 T C 7: 133,919,524 T312A probably damaging Het
Adamts20 C T 15: 94,283,916 C1632Y probably damaging Het
Ago2 T C 15: 73,119,461 M543V probably benign Het
Alpk3 T C 7: 81,094,970 L1271P probably damaging Het
Arpin T A 7: 79,931,805 K56* probably null Het
Ccdc138 G T 10: 58,561,893 probably benign Het
Ccdc63 A T 5: 122,122,885 M192K probably benign Het
Cldn12 A T 5: 5,507,845 V194D possibly damaging Het
Cntnap5b T C 1: 100,379,126 L485P probably damaging Het
Cpne7 A G 8: 123,124,469 D165G probably damaging Het
Cyp2j6 A T 4: 96,529,408 M326K probably damaging Het
D630003M21Rik T A 2: 158,201,011 T870S probably damaging Het
Dennd2c A G 3: 103,132,001 D155G probably benign Het
Dnah3 A T 7: 120,045,788 probably null Het
Dqx1 T A 6: 83,059,087 C133* probably null Het
Fam234b T A 6: 135,231,724 V545E probably damaging Het
Flcn T C 11: 59,792,659 H564R probably damaging Het
Gsdmc4 T A 15: 63,893,165 H348L probably benign Het
Gucy2c G T 6: 136,763,074 P252T probably damaging Het
Insl6 T A 19: 29,325,245 E24V possibly damaging Het
Irx1 T A 13: 71,960,048 T172S probably damaging Het
Mocos C T 18: 24,666,656 probably benign Het
Myom2 T C 8: 15,108,835 V837A probably benign Het
Nfatc2ip T C 7: 126,395,998 N126S probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Npepl1 T C 2: 174,111,773 S166P probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr867 G T 9: 20,055,088 A125D probably damaging Het
Otop2 T G 11: 115,326,850 C171G probably damaging Het
Parpbp C A 10: 88,133,088 probably benign Het
Pcdhb20 T A 18: 37,504,510 S30T probably benign Het
Phkg1 A T 5: 129,864,532 V359E probably damaging Het
Scn9a A G 2: 66,504,968 Y1226H probably damaging Het
Unc5b A G 10: 60,778,200 F290S probably benign Het
Vmn1r71 A G 7: 10,747,919 F215L probably benign Het
Vmn2r101 T C 17: 19,589,783 V277A probably benign Het
Vmn2r6 T C 3: 64,556,352 S354G probably benign Het
Zfp292 A T 4: 34,811,281 S588T probably damaging Het
Other mutations in Ppp2cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:Ppp2cb APN 8 33611763 missense probably benign 0.38
IGL02985:Ppp2cb APN 8 33615446 unclassified probably benign
IGL03251:Ppp2cb APN 8 33610651 splice site probably benign
Breakthrough UTSW 8 33615474 missense probably damaging 1.00
R0940:Ppp2cb UTSW 8 33615661 splice site probably null
R1688:Ppp2cb UTSW 8 33615452 missense probably benign 0.02
R2187:Ppp2cb UTSW 8 33610677 missense possibly damaging 0.95
R4418:Ppp2cb UTSW 8 33617049 missense probably benign
R4566:Ppp2cb UTSW 8 33610695 missense possibly damaging 0.67
R6187:Ppp2cb UTSW 8 33615474 missense probably damaging 1.00
R6990:Ppp2cb UTSW 8 33619133 missense probably benign 0.01
R7477:Ppp2cb UTSW 8 33615474 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACCCGAGTCTAAGCATAAAATC -3'
(R):5'- CAGGTTCAACTCTGCAGCAC -3'

Sequencing Primer
(F):5'- CGAGTCTAAGCATAAAATCCACTTG -3'
(R):5'- TCAACTCTGCAGCACTGTATTAAAC -3'
Posted On2014-10-30